На главную
На главную

Методические указания по санитарно-эпидемиологической оценке безопасности и функционального потенциала пробиотических микроорганизмов, используемых для производства пищевых продуктов

Методические указания устанавливают требования к микро- биологической, биохимической, молекулярно-генетической и гигиенической оценке штаммов, используемых в качестве стартовых культур для изготовления пробиотических заквасок, включая закваски прямого внесения, бактериальных концентратов и микробной биомассы для производства пробиотических пищевых продуктов и биологически активных добавок к пище, и необходимые методы лабораторных исследований для ее осуществления. Методические указания предназначены для юридических лиц и индивидуальных предпринимателей, деятельность которых связана с разработкой, производством и обращением биотехнологической продукции, а также для испытательных лабораторных центров, осуществляющих контроль качества и безопасности продовольственного сырья и пищевых продуктов и БАД к пище и аккредитованных в установленном порядке на данный вид деятельности.

Обозначение: МУ 2.3.2.2789-10
Название рус.: Методические указания по санитарно-эпидемиологической оценке безопасности и функционального потенциала пробиотических микроорганизмов, используемых для производства пищевых продуктов
Статус: введен впервые
Дата актуализации текста: 05.05.2017
Дата добавления в базу: 12.02.2016
Дата введения в действие: 06.12.2010
Утвержден: 06.12.2010 Главный государственный санитарный врач Российской Федерации
Опубликован: Роспотребнадзор (2011 г. )
Ссылки для скачивания:

Государственное санитарно-эпидемиологическое нормирование
Российской Федерации

2.3.2. ПРОДОВОЛЬСТВЕННОЕ СЫРЬЕ И ПИЩЕВЫЕ ПРОДУКТЫ

Методические указания по санитарно-
эпидемиологической оценке безопасности
и функционального потенциала пробиотических
микроорганизмов, используемых
для производства пищевых продуктов

Методические указания
МУ 2.3.2.2789-10

Москва 2011

1. Авторский коллектив: Научно-исследовательский институт питания РАМН (В.А. Тутельян, С.А. Шевелёва, С.А. Хотимченко, В.А. Исаков, И.Я. Конь, В.К. Мазо, Н.Р. Ефимочкина, Э.Н. Трушина, С.Ю. Батищева, А.В. Черкашин, А.В. Булахов); Учреждение Российской академии наук Институт общей генетики им. Н.И. Вавилова РАН (Н.К. Янковский, В.Н. Даниленко, С.Г. Ботина, О.В. Аверина); ФГУН «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Габричевского» Роспотребнадзора (В.А. Алешкин, Б.А. Шендеров, А.М. Амерханова, О.Г. Жиленкова, А.В. Алёшкин, М.С. Бляхер, И.М. Федорова, Е.А. Воропаева, Ю.В. Черепанова); ФГБУ Научно-исследовательский институт эпидемиологии и микробиологии им. почетного академика РАМН Н.Ф. Гамалеи Минздравсоцразвития России (А.Л. Гинцбург, Ю.В. Ананьина, Б.С. Народицкий, Н.А. Зигангирова, Л.Н. Нестеренко, И.А. Шагинян, М.Ю. Чернуха, А.А. Ховаев); ГОУ ВПО Тверская государственная медицинская академия «Федерального агентства по здравоохранению и социальному развитию Российской Федерации» (В.М. Червинец, Ю.В. Червинец); Московский государственный университет им. М.В. Ломоносова (В.В. Зинченко, Е.А. Карбышева); при участии ВНИМИ РАСХН (В.Д. Харитонов, В.Ф. Семенихина, И.В. Рожкова, В.Г. Будрик), ООО «Бактотех» (А.И. Туркин).

2. Рекомендованы Комиссией по государственному санитарно-эпидемиологическому нормированию при Федеральной службе по надзору в сфере защиты прав потребителей и благополучия человека, (протокол от 14.10.2010 № 2).

3. Утверждены Руководителем Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека, Главным государственным санитарным врачом Российской Федерации Г.Г. Онищенко 6 декабря 2010.

4. Введены в действие с момента утверждения.

5. Введены впервые.

СОДЕРЖАНИЕ

Введение. 3

1. Область применения. 4

2. Общие положения. 4

3. Нормативные ссылки. 7

4. Термины и определения. 7

5. Методы исследования таксономической принадлежности пробиотических штаммов. 8

5.1. Микробиологические исследования фенотипических свойств штаммов. 8

5.2. Биохимические исследования фенотипических свойств штаммов. 8

5.2.1. Аппаратура, материалы, лабораторная посуда, реактивы и питательные среды.. 9

5.2.2. Методика проведения биохимической идентификации штамма. 11

5.3. Молекулярно-генетическое подтверждение таксономического статуса штаммов, установленного на основании фенотипических свойств. 12

5.3.1. Методика молекулярно-генетического анализа таксономической принадлежности бифидобактерий. 12

5.3.2. Методика молекулярно-генетического анализа таксономической принадлежности лактобактерий. 16

6. Методы исследования биологических свойств пробиотических штаммов. 18

6.1. Основные методы исследования безопасности штаммов в тестах in vitro. 18

6.1.1. Определение фенотипического профиля чувствительности/резистентности штамма к антимикробным препаратам.. 18

6.1.2. Определения отсутствия трансмиссивных генов антибиотикорезистентности. 21

6.1.3. Определение отсутствия (наличия) плазмидного материала. 23

6.1.4. Определение профиля органических продуктов (кислот, биогенных аминов, аммиака, пероксида водорода), продуцируемых штаммом.. 26

6.1.5. Определение способности к деконъюгации желчных солей. 31

6.1.6. Определение способности к гидролизу муцина. 31

6.1.7. Определение способности пробиотических штаммов ингибировать представителей нормофлоры кишечника in vitro. 32

6.1.8. Определение степени иммуномодуляции. 34

6.2. Основные методы исследования безопасности штаммов в тестах in vivo. 35

6.2.1. Определение способности к гидролизу мукозного слоя стенки кишечника. 35

6.2.2. Способность к транслокации у иммунодефицитных животных. 35

6.2.3. Изучение фагоцитарной активности штаммов. 36

6.3. Дополнительные методы исследования безопасности штаммов. 37

6.3.1. Тестирование in vitro. 37

6.3.2. Тестирование in vivo. 39

6.4. Основные методы исследования пробиотического потенциала штаммов. 40

6.4.1. Тестирование in vitro. 40

6.5. Дополнительные методы исследования пробиотического потенциала штаммов. 48

6.5.1. Тестирование in vitro. 48

6.5.2. Тестирование in vivo. 54

7. Методы исследования технологических свойств пробиотических штаммов. 56

7.1. Определение постокислительной активности штаммов молочнокислых бактерий. 56

7.2. Определение способности к образованию экзополисахаридов. 56

7.3. Тестирование хранимоспособности. 57

7.3.1. Определение числа жизнеспособных бифидобактерий и лактобацилл методом конечных разведений. 57

7.3.2. Количественное определение ацидофильных лактобацилл. 57

7.3.3. Контроль микробной культуры на наличие посторонней микрофлоры.. 58

7.3.4. Изучение морфологии клеток. 58

7.3.5. Определение активности кислотообразования. 58

8. Библиография. 59

Приложение 1. Микробиологический и молекулярно-генетический паспорт штамма микроорганизма. 62

Приложение 2. Пограничные значения чувствительности к антимикробным веществам лактобактерий в микрометоде серийных разведений [по I. Klare et al., 2007] 63

 

 

УТВЕРЖДАЮ

Руководитель Федеральной службы
по надзору в сфере защиты прав
потребителей и благополучия человека,
Главный государственный санитарный
врач Российской Федерации

_____________________Г.Г. Онищенко

6 декабря 2010 г.

Дата введения: с момента утверждения

2.3.2. ПРОДОВОЛЬСТВЕННОЕ СЫРЬЕ И ПИЩЕВЫЕ ПРОДУКТЫ

Методические указания по санитарно-
эпидемиологической оценке безопасности
и функционального потенциала пробиотических
микроорганизмов, используемых
для производства пищевых продуктов

Методические указания
МУ 2.3.2.2789-10

Введение

Опыт широкого применения пробиотиков в пищевой промышленности в целом подтверждает историю безопасного употребления в пищу человека микроорганизмов-симбионтов кишечной микрофлоры, к которым относится большинство пробиотиков, и отсутствие у них способности обусловливать у потребителей заболевания инфекционного и инвазионного характера. В то же время, как признают эксперты ФАО-ВОЗ, пробиотики потенциально могут быть ответственны за ряд побочных эффектов (септические инфекции, избыточная метаболическая активность, гиперстимуляция факторов локального иммунитета, передача генов представителям нормофлоры организма человека). Наибольшую актуальность в этом аспекте на сегодняшний день приобретает требование к контролю отсутствия у штаммов трансмиссивных генов, прежде всего антибиотикорезистентности.

Накопленные в области нутрициологии и микробиологии данные также свидетельствуют о штаммоспецифичности благоприятного воздействия пробиотиков на здоровье человека. В связи с этим, согласно международным требованиям таксономическая принадлежность пробиотических штаммов должна устанавливаться с использованием современных воспроизводимых молекулярно-генетических методов. Подтверждение пробиотического потенциала стартерных культур пробиотиков должно быть основано на научной доказательной базе.

Настоящие методические указания разработаны с целью обеспечения единого, научно-обоснованного подхода к оценке качества и безопасности штаммов пробиотических микроорганизмов (далее - штаммов), предназначенных для производства пробиотических заквасок прямого внесения, бактериальных концентратов и микробной биомассы, являющейся компонентом пробиотических пищевых и биологически активных добавок или используемых для обогащения традиционных пищевых продуктов и биологически активных добавок; совершенствования нормативной базы, регулирующей оборот продукции, выработанной с использованием живых пробиотических микроорганизмов.

1. Область применения

1.1. Методические указания устанавливают требования к микробиологической, биохимической, молекулярно-генетической и гигиенической оценке штаммов, используемых в качестве стартовых культур для изготовления пробиотических заквасок, включая закваски прямого внесения, бактериальных концентратов и микробной биомассы для производства пробиотических пищевых продуктов и биологически активных добавок к пище, и необходимые методы лабораторных исследований для её осуществления.

1.2. Методические указания предназначены для юридических лиц и индивидуальных предпринимателей, деятельность которых связана с разработкой, производством и обращением биотехнологической продукции, а также для испытательных лабораторных центров, осуществляющих контроль качества и безопасности продовольственного сырья и пищевых продуктов и БАД к пище и аккредитованных в установленном порядке на данный вид деятельности.

2. Общие положения

2.1. Санитарно-эпидемиологическая оценка штаммов, отобранных по специфическим функциональным пробиотическим свойствам, включает в себя комплекс микробиологических, биохимических, молекулярно-генетических и гигиенических исследований для подтверждения их безопасности (безвредности), а также наличия у них свойств, обусловливающих пробиотический эффект в организме, и поэтому пригодных для создания пробиотических продуктов питания и биологически активных добавок к пище.

2.2. Положения, изложенные в настоящих методических указаниях, применяются при разработке технической документации на продукцию, а также на этапе предрегистрационных испытаний (исследований) впервые разрабатываемой или впервые ввозимой на территорию Российской Федерации продукции.

2.3. В составе пробиотических заквасочных культур, бактериальных концентратов и микробной биомассы для производства пробиотических пищевых продуктов и биологически активных добавок к пище, содержащих живые микроорганизмы, могут использоваться отдельные штаммы (или консорциумы штаммов), принадлежащие к родам бифидобактерий (Bifidobacterium spp.), лактобацилл (Lactobacillus spp.), пропионовокислых бактерий (Propionibacterium spp.) и др., за исключением родов и видов микроорганизмов, перечисленных в СанПиН 2.3.2.2567-09 «Дополнение 15 к СанПиН 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов».

2.4. Для обеспечения безопасности и пригодности пробиотических пищевых продуктов и биологически активных добавок к пище, содержащих живые микроорганизмы, штаммы для производства должны отвечать следующим требованиям:

2.4.1) должны быть преимущественно изолированы (без применения каких-либо биотехнологических воздействий на штамм) из представителей симбиотической резидентной микрофлоры желудочно-кишечного тракта здоровых людей. В иных случаях и в случаях, когда потенциальная пробиотическая культура изолирована из пищевого продукта, организма животного или другого объекта окружающей среды, наряду с происхождением штамма, должен быть известен способ селекции (индуцированный мутагенез, адаптация к определенным факторам, генно-инженерные манипуляции, в том числе самоклонирование, и др.) этих микроорганизмов;

2.4.2) таксономическая принадлежность должна быть установлена до уровня штамма путем изучения широкого спектра фенотипических характеристик и подтверждена с использованием воспроизводимых молекулярно-генетических методов;

2.4.3) номенклатурное название штамма должно приводиться в соответствии с кодами современной международной классификации (по Approval Lists of Bacterial Names in International Journal of Systematic Bacteriology, 1980, v. 30, 225 - 420 http://www.bacterio.cici.fr/) или Validation Lists in the International Journal of Systematic and Evolutionary Microbiology) и включать обозначение рода, вида и штамма;

2.4.4) должны быть задепонированы в национальных или международных коллекциях микробных культур Российской Федерации на условиях контрольного хранения (для отечественных производителей - ВКПМ ФГУП ГосНИИгенетика или ФГУН МНИИЭМ им. Г.Н. Габричевского, Москва; для зарубежных - международная коллекция микроорганизмов при ВКПМ ФГУП ГосНИИгенетика), сопровождаться справкой о депонировании и паспортом штамма с указанием подробной таксономической характеристики, источника и даты выделения, анатомической области изоляции, присущих штамму фенотипических и генетических характеристик, в т.ч. наличия внехромосомного генетического материала. Форма паспорта на штамм и перечень включаемых в него характеристик приведены в прилож. 1;

2.4.5) должны принадлежать к видам, имеющим документированную историю применения в пищу человеку, не должны обладать факторами патогенности, токсигенности и не вызывать заболеваний у людей и теплокровных животных;

2.4.6) должны иметь изученный профиль антибиотикорезистентности в отношении современных применяемых в медицине антибиотиков и не обладать антибиотикорезистентностью трансмиссивного типа;

2.4.7) должны иметь стабильные фенотипические, генотипические и технологические характеристики; иметь изученный профиль внехромосомных элементов (плазмид, транспозонов, бактериофагов и др.), при наличии внехромосомных элементов их функциональная роль должна быть охарактеризована и доказана неспособность к генному трансферу;

2.4.8) не должны обладать способностью к транслокации в лимфоузлы, паренхиматозные органы, кровь у человека и теплокровных животных, обладающих иммунодефицитностью;

2.4.9) не должны обладать способностью к иммуносупрессии или избыточной иммуностимуляции, а также генерации провоспалительного эффекта in vitro и in vivo;

2.4.10) не должны обладать способностью образовывать новые метаболические продукты или избыток известных продуктов, в количествах, способных вызывать побочные эффекты;

2.4.11) не должны ингибировать рост представителей нормальной резидентной микрофлоры желудочно-кишечного тракта человека и теплокровных животных.

2.5. Изучение штаммов по показателям, указанным в п.п. 2.4.5 - 2.4.11, характеризующим их безопасность, проводится путем тестирования in vitro и в экспериментах in vivo (на моделях конвенциональных линейных лабораторных животных обоего пола, обычно применяемых в нутрициологии - мышах, крысах, морских свинках, кроликах, с пероральным введением стандартных и аггравированных доз (до 1011 КОЕ и более в 1 г инокулята, но не менее 109 КОЕ на животное).

В необходимых случаях могут быть использованы животные-гнотобионты.

2.6. В случае использования генно-инженерно-модифицированных пробиотических штаммов оценка их безопасности проводится в соответствии с требованиями, включенными в МУ 2.3.2.1830-04 «Микробиологическая и молекулярно-генетическая оценка пищевой продукции, полученной с использованием генетически модифицированных микроорганизмов» и СанПиН 2.3.2.2340-08 «Дополнения и изменения 6 к СанПиН 2.3.2.1078-01 «Гигиенические требования безопасности и пищевой ценности пищевых продуктов».

2.7. Для штаммов зарубежного производства, впервые ввозимых на территорию Российской Федерации, в т.ч. в составе заквасок, пробиотических пищевых продуктов и биологически активных добавок к пище с живой микрофлорой, необходимо документальное подтверждение разрешения их использования в пищевой промышленности и/или в свободной продаже населению, со стороны компетентных органов страны-изготовителя.

2.8. Потенциальные пробиотических штаммы должны быть охарактеризованы на наличие у них функциональных (пробиотических) свойств. Тестирование функциональных свойств должно совмещать скрининг in vitro с экспериментальной оценкой in vivo на животных, указанных в п. 2.5; в необходимых случаях должны предусматриваться клинические испытания выработанных с включением штаммов опытно-промышленных образцов пробиотических продуктов и БАД к пище.

2.8.1. У всех штаммов должна быть изучена выживаемость в проксимальных отделах ЖКТ и пролиферация в толстом кишечнике, устойчивость к действию кислотности желудка, желчи, адгезия к эпителиальным клеткам человека и клеточным культурам, антагонистическая активность против патогенных и условно-патогенных микроорганизмов-возбудителей острых кишечных инфекций и других инфекций с пищевым путем передачи, способность снижать их адгезию в кишечнике, способность к гидролизу желчных кислот.

2.8.2. В необходимых случаях штаммы должны быть охарактеризованы на способность к продукции биологически активных веществ и других факторов, обусловливающих пробиотический эффект (иммунопептидов, антимикробных веществ, в т.ч. бактериоцинов, органических кислот, в т.ч. короткоцепочечных жирных кислот, экзополисахаридов, профиль взаимодействия с клетками иммунной системы и модуляции цитокинов, расщеплению холестерина, антиоксидантной активности и т.д.).

2.9. У потенциальных пробиотических штаммов должны быть охарактеризованы технологические характеристики.

2.9.1. Штаммы, отбираемые для заквасок, бакконцентратов или биомасс, должны сохранять жизнеспособность, генетическую стабильность, функциональные пробиотические характеристики на всех этапах производства, транспортировки и хранения, не сообщать продукту неудовлетворительных вкусов и запахов.

2.9.2. Штаммы, отбираемые для производства мультипробиотических консорциумов, многокомпонентных продуктов, включающих ингредиенты с антимикробной активностью (эфирные масла, лекарственные растения, йод и его соединения, пищевые волокна-адсорбенты и др.) должны быть испытаны на совместимость и хранимоспособность в течение всего срока годности.

2.10. Все исследования и эксперименты на лабораторных животных проводятся по принципам доказательности (наличие контрольных штаммов и групп интактных животных, количество подопытных животных, достаточное для получения статистически значимых результатов).

3. Нормативные ссылки

3.1. Федеральный закон от 02.01.2000 № 29-ФЗ «О качестве и безопасности пищевых продуктов» (с изменениями и дополнениями).

3.2. Федеральный Закон от 07.02.1992 № 2300-1 «О защите прав потребителей» (с изменениями и дополнениями).

3.3. Федеральный Закон от 23.09.1992 № 3520-1 «О товарных знаках, знаках обслуживания и наименованиях мест происхождения товаров» (с изменениями и дополнениями).

3.4. Федеральный закон от 27.12.2002 № 184-ФЗ «О техническом регулировании» (с изменениями и дополнениями).

3.5. Федеральный закон от 12.06.2008 № 88-ФЗ «Технический регламент на молоко и молочную продукцию» (с изменениями и дополнениями).

3.6. Федеральный закон от 24.06.2008 № 90-ФЗ «Технический регламент на масложировую продукцию».

3.7. Постановление Правительства Российской Федерации от 22 ноября 2000 г. № 883 «Об организации и проведении мониторинга качества, безопасности пищевых продуктов и здоровья населения».

3.8. Постановление Правительства Российской Федерации от 21 декабря 2000 г. № 987 «О государственном надзоре и контроле в области обеспечения качества и безопасности пищевых продуктов».

3.9. Постановление Правительства РФ от 14.12.2009 № 1009 «О порядке совместного осуществления Министерством здравоохранения и социального развития Российской Федерации и Министерством сельского хозяйства Российской Федерации функций по нормативно-правовому регулированию в сфере контроля за качеством и безопасностью пищевых продуктов и по организации такого контроля».

3.10. СанПиН 2.3.2.1078-01 «Гигиенические требования к качеству и безопасности продовольственного сырья и пищевых продуктов» (с изменениями и дополнениями).

3.11. Единые санитарно-эпидемиологические и гигиенические требования к товарам, подлежащим санитарно-эпидемиологическому надзору (контролю) Таможенного союза ЕврАзЭС.

3.12. СП 1.3.2322-08 «Безопасность работы с микроорганизмами III - IV групп патогенности (опасности) и возбудителями паразитарных болезней».

4. Термины и определения

Пробиотические микроорганизмы - живые непатогенные, нетоксигенные микроорганизмы, представители защитных групп нормального кишечного микробиоценоза человека и природных симбиотических ассоциаций, благотворно влияющие на организм человека путем улучшения (оптимизации) состава и биологической активности микрофлоры его пищеварительного тракта.

Антагонизм - подавление жизнедеятельности одной микробной культуры (микробной популяции) другой за счет выделения в среду культивирования или совместного обитания веществ (антибиотиков, бактериоцинов, органических и жирных кислот), препятствующих росту или задерживающих размножение.

Симбиоз - благоприятное влияние друг на друга двух и более популяций микроорганизмов при совместном существовании путем улучшения условий своей жизнедеятельности.

Генно-инженерно-модифицированные микроорганизмы (ГММ) - бактерии, дрожжи, мицелиальные грибы, вирусы, в которых генетический материал изменен с использованием методов генной инженерии, то есть путем, который не имеет места в природе при размножении и/или при естественных рекомбинациях.

Антибиотикорезистентность трансмиссивная (трансферабельная) - устойчивость микроорганизмов к антибиотикам, закодированная на внехромосомных генных элементах микробной клетки, наиболее часто встречающийся селективный маркер рекомбинантной ДНК ГММ.

Пробиотические закваски прямого внесения - чистые культуры специально подобранных отдельных штаммов живых пробиотических микроорганизмов, а также смесей штаммов в питательных средах, использованных для их выращивания, либо суспензии вегетативных клеток (в т.ч. концентрированные) без или со средой культивирования, приготовленные на специализированных предприятиях, и предназначенные для прямого внесения в подготовленное сырье непосредственно в резервуарах для производства пробиотического продукта. Пробиотические закваски прямого внесения могут выпускаться в сухом виде, в т.ч. лиофилизированном из замороженного состояния, или в жидком, в т.ч. замороженном.

5. Методы исследования таксономической принадлежности
пробиотических штаммов

Таксономическая принадлежность штаммов устанавливается на основе полифазного таксономического подхода, использующего комплекс генотипических и ключевых фенотипических тестов, что позволяет с наибольшей степенью точности установить принадлежность микроорганизмов к таксону на уровне вида и штамма.

Разработчиком (поставщиком) должны быть предоставлены данные о сравнения фенотипических свойств штамма с характерными фенотипическими свойствами его вида, описанными в определителе Берги (Bergey’s manual of systematic bacteriology. Eds. Sneaht P.N.D. et al. Baltimore; Williams and Wilkins, 1986, v. 2).

Исследования проводятся при использовании контрольных (референтных) штаммов данного вида из официальных депозитариев.

Результаты тестирования таксономической принадлежности по фенотипическим признакам одновременно могут использоваться для оценки штаммов в соответствии с требованиями п. 2.4 настоящих методических указаний.

5.1. Микробиологические исследования
фенотипических свойств штаммов

На данном этапе идентификации определяются основные фенотипические признаки чистой культуры штамма: культуральные свойства колоний, морфология клеток в микроскопических препаратах (в живом и зафиксированном виде), отношение к окраске по Граму, способность к спорообразованию, а также каталазная и нитратредуцирующая активность при использовании общепринятых в микробиологии методов анализа.

Чистую культуру штамма выделяют на рекомендованной для данного вида микроорганизмов питательной среде, позволяющей получать изолированные колонии. Например, выделение чистой культуры лактобактерий должно осуществляться со среды MRS, термофильных стрептококков - со среды типа M17 по ГОСТ Р 51331-99, бифидобактерий - со среды Блаурокка, среды для бифидобактерий (г. Оболенск) или тиогликолевой среды.

Потенциальные пробиотические штаммы должны обладать типичными для рода культуральными признаками на всех типах сред (твердых, полужидких и жидких) без признаков диссоциации, а также однородными морфологическими, тинкториальными свойствами, окрашиваться по Граму положительно, не иметь спор и капсул, не восстанавливать нитраты, не продуцировать каталазу.

5.2. Биохимические исследования фенотипических
свойств штаммов

Исследования проводятся для подтверждения принадлежности к роду и дифференциации видов. Оптимальными для данной цели являются методы идентификации микроорганизмов с помощью биохимических диагностических тест-панелей одноразового пользования, отечественного и зарубежного производства, зарегистрированных в РФ в установленном порядке.

Для лактобактерий анализируется профиль ферментации расширенного набора углеводов и аминокислот (не менее 49 наименований).

Биохимическая идентификация бифидобактерий включает рутинную предварительную дифференциацию с определением их ферментативного профиля по укороченному спектру углеводов и многоатомных спиртов: лактоза, глюкоза, ксилоза, целлобиоза, рамноза, инулин, манноза, маннит, сорбит, инозит. С этой целью используют 1 %-е растворы десяти вышеперечисленных углеводов, приготовленных на основе полужидкой питательной среды (пептон - 10 г, кукурузный экстракт - 30 мл, цистин солянокислый - 0,2 г, хлористый натрий - 2,0 г, агар-агар - 0,75 г на 1 л дистиллированной воды и соответствующего индикатора pH).

После проверки чистоты культуры с помощью микроскопии, с поверхности агаровой пластины снимают выросшие колонии петлей и ресуспендируют в стерильном растворе хлорида натрия для получения взвеси, содержащей 1 миллиард клеток бактерий в 1 мл по стандарту мутности (ОСО 42-28-59-85). Полученную взвесь бактерий в количестве 0,01 мл вносят в 1 мл основы (т.е. концентрация взвеси клеток в основе среды равна 107).

Растворы тестируемых углеводов и многоатомных спиртов вносят по 0,1 мл каждого в ряд лунок планшета для иммунологических исследований. В каждую из лунок затем добавляют по 0,1 мл взвеси испытуемой культуры бифидобактерий. В последнюю очередь в каждую лунку добавляют по 1 капле стерильного вазелинового масла. Для контроля среды в одну лунку помещают по 0,1 мл основы среды, по 0,1 мл взвеси испытуемой культуры и по 1 капле вазелинового масла. Для контроля жизнеспособности культуры во взвеси ее вносят в БС-среду.

Все посевы инкубируют при 37 °С в течение 24 ч в анаэробных условиях, после чего осуществляют предварительный учет результатов; окончательно результаты учитывают через 48 ч.

Результаты учитывают по изменению окраски среды в лунках: положительный результат - желтое окрашивание, отрицательный - фиолетовое.

Детальное изучение биохимических свойств штаммов, показавших положительные реакции с соответствующими субстратами, изучают при использовании параллельно трех биохимических тест-систем:

а) типа API-20CHL (bioMerieux, Франция)

б) типа API-50CHL (bioMerieux, Франция)

б) типа АНАЭРОтест 23 (PLIDA-Lachema diagnostica s.r.o., Чехия)

5.2.1. Аппаратура, материалы, лабораторная посуда, реактивы и
питательные среды *

________

* Допускается использование других аппаратуры, материалов, реактивов, питательных сред и диагностических тест-систем с аналогичными характеристиками, прошедших регистрацию в РФ в установленном порядке. При их применении необходимо руководствоваться рекомендациями изготовителя.

А) аппаратура и инструментарий

Анализатор потенциометрический, погрешность измерений pH ±0,01

ГОСТ 19881-74

Шкаф сушильный стерилизационный ШСС-80П или других марок, позволяющий поддерживать температуру (160 ± 5) °С

ТУ 64-1-28-70-76

Термостат, позволяющий поддерживать рабочую температуру 28 - 37 °С с отклонением от заданной ±1 °С

ТУ 64-1-1382-72

Баня водяная с подогревом

ГОСТ 12026-76

Весы лабораторные общего назначения, 2 и 4 класса точности, с наибольшим пределом взвешивания 200 г

ГОСТ 24104-88

Микроскоп биологический МБИ-2, МБИ-3, МБР-3

ГОСТ 8284-78

Стерилизаторы паровые медицинские и аналогичные

ГОСТ 19569-89Е

Дистиллятор, обеспечивающий качество дистиллированной воды в соответствии с

ГОСТ 6709-72

Облучатель бактерицидный настенный ОБН-150 или других видов

ТУ 16-535-84

Холодильник бытовой электрический

 

Пинцет медицинский

ГОСТ 21241-89

Ножницы медицинские

ГОСТ 21239-89

Скальпель хирургический, 15 см

ГОСТ 21240-89

Микробиологические петли

 

Штативы для пробирок

 

Часы механические сигнальные

ГОСТ 3145-84

Микроволновая печь

 

Б) лабораторная посуда и материалы

Бумага фильтровальная лабораторная

ГОСТ 12026-76

Бутыли стеклянные для химических реактивов

 

Кастрюли эмалированные

ГОСТ 24778-81

Марля медицинская

ГОСТ 9412-77

Колбы плоскодонные конические или круглые разной вместимости

ГОСТ 1770-74

Воронки стеклянные

ГОСТ 25336-82

Вата медицинская гигроскопическая

ГОСТ 5556-81

Полистироловые планшеты U-образные

 

Пробирки типов типов П1, П2

ГОСТ 25336-82

Стекла предметные для микропрепаратов

ГОСТ 6672-75

Ступка фарфоровая с пестиком

ГОСТ 9147-80

Термометр ртутный с диапазоном измерения от 0 до 100 °С (цена деления шкалы 1 °С)

ГОСТ 13646-68

Чашки биологические (Петри)

ГОСТ 23932-90

Книга-каталог кодов или комплект программного обеспечения для идентификации

 

Бланки для регистрации результатов

 

Микробиологические петли

 

Фломастеры-маркеры

 

В) реактивы и питательные среды

Агар микробиологический

ГОСТ 17206-84

Вода дистиллированная

ГОСТ 6709-72

D-глюкоза, ч

ГОСТ 6038-79

D-лактоза, 1-водная

ТУ 6-09-22-98-79

Натрий фосфорно-кислый однозамещенный, ч

ГОСТ 4198-75

Натрий фосфорно-кислый двухзамещенный, хч

ГОСТ 2493-75

Кислота соляная, хч

ГОСТ 3118-77

Натрий хлористый, хч

ГОСТ 4328-77

Масло иммерсионное для микроскопии

ГОСТ 31739-78

Набор реактивов для окраски по Граму

 

Спирт этиловый ректификованный технический

ГОСТ 18300-87

Спирт этиловый ректификованный

ГОСТ Р 51652-2000

Экстракт дрожжевой

 

Триптон

 

Антибиотики разных групп

 

Диски с антибиотиками

 

Реактивы производства разных фирм, прошедшие государственную регистрацию и разрешенные для использования в установленном порядке.

Г) питательные среды

Среды для выращивания бифидобактерий, молочнокислых и пропионовокислых бактерий: ГМС, M17, MRS, БС-среда (для культивирования и выделения бифидобактерий НИИ ПМ, г. Оболенск)

НД изготовителя

Д) тест-панели для идентификации культур

API-20CHL и API-50CHL

по спецификации изготовителя

АНАЭРОтест 23

по спецификации изготовителя

Е) стандарт мутности по McFarland или ОСО

Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29000.

5.2.2. Методика проведения биохимической идентификации штамма

Из чистой 18 - 24-часовой культуры готовят суспензию в стерильной дистиллированной воде. Суспензию тщательно гомогенизируют. Суспензию доводят до определенной мутности по шкале McFarland в зависимости от вида исследуемого штамма. Неправильно приготовленная суспензия (слишком густая или очень жидкая) может привести к получению ложных результатов.

Параллельно суспензию штамма или контрольного штамма высевают на питательные среды для проверки чистоты культуры, ее ростовых свойств и/или постановки дополнительных тестов.

Планшет для идентификации извлекают из упаковки и на прилагаемом к планшету бланке регистрируют номер испытуемого штамма и контрольного штамма.

Суспензию бактерий тщательно встряхивают и в каждую лунку инокулируют определенный объем суспензии (0,1 - 0,2 см3) в зависимости от требований фирмы-изготовителя и вида исследуемого штамма.

После инокуляции в ряд лунок может добавляться стерильное вазелиновое масло, полностью закрывающее внесенную суспензию клеток для создания анаэробных условий.

После инокуляции планшет накрывают крышкой и инкубируют 5 - 24 ч при оптимальной температуре для исследуемого вида (например, 42 °С - лактобациллы).

По окончании инкубации результаты учитывают визуально, отмечая цвет каждой лунки, и заносят в прилагаемые бланки.

В некоторые лунки (например, для ферментация индола) могут быть добавлены реактивы. Учет результатов на бета-галактозидазу проводят дважды: через 3 - 5 и 18 - 24 ч.

Идентификацию проводят с помощью таблиц, книг-каталогов кодов, компьютерного обеспечения соответствующих фирм-изготовителей, в заключении, учитывая данные, полученные по п. 5.1.1, указывают род и вид штамма.

Тестирование биохимических свойств используют для проверки стабильности фенотипических свойств штамма. Для этого культуру подвергают пассированию на жидких и плотных питательных средах и повторному через 3 - 5 пассажей тестированию биохимических свойств.

Трехкратное совпадение всех исследованных биохимических реакций, выявленное при пассировании культур (не менее 10 пассажей), свидетельствует о стабильности фенотипических признаков. Вариабельность результатов по 1 - 2 реакциям свидетельствует о необходимости постановки дополнительных тестов на стабильность фено- и генотипических признаков штамма. Вариабельность результатов по большему числу реакций является свидетельством нестабильности фенотипических признаков и непригодности штамма для использования в пищевой промышленности.

5.3. Молекулярно-генетическое подтверждение
таксономического статуса штаммов, установленного
на основании фенотипических свойств

Для подтверждения таксономического положения штамма разработчик должен представить информацию об уровне его гомологии с штаммами этого вида, допущенными для использования в пищевой промышленности при создании аналогичной продукции. Разработчик (поставщик) должен представить информацию о нуклеотидной последовательности не менее двух локусов генома штамма, а также другие материалы, отражающие молекулярно-биологические характеристики.

5.3.1. Методика молекулярно-генетического анализа таксономической
принадлежности бифидобактерий

Принцип метода. Молекулярно-генетическая идентификация штаммов молочнокислых бактерий базируется на определении последовательностей информационного гена 16S рРНК и фрагментов операционных генов, кодирующих ферменты у бифидобактерий. Поскольку филогения по 16S рРНК в значительной степени соотносится с эволюционной историей организмов, формируемые группы по последовательности гена 16S рРНК, как правило, подтверждаются данными анализов фенотипических свойств. Для более детальной штаммоспецифической идентификации используется подход двухлокусного секвенирования, в частности с использованием β-субъединицы F0F1 АТФазы, или гена трансальдолазы [4] в случае отсутствия ПРЦ - фрагментов с видоспецифическими праймерами.

5.3.1.1. Оборудование, материалы, лабораторная посуда, реактивы *

________

* Допускается использовать других оборудование, материалы, лабораторную посуду, реактивы с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

A) аппаратура и инструментарий

Анаэростат для анаэробного выращивания микроорганизмов или система газогенераторная настольная;

Термостат суховоздушный;

Высокоскоростная микроцентрифуга;

Микротермостат «Термит»;

Амплификатор типа «Терцик» или РТС-0150;

Камера для горизонтального электрофореза «SE-2»;

Источник питания;

Трансиллюминатор TCP-20 МС.

Б) питательные среды

Бульон и агар МРС с 0,5 % цистеина

B) реактивы и материалы

Трис НСl

ЭДТА

NaCl

Тритон-Х100

саркозил

додецилсульфат натрия (SDS)

фенол

оксихинолин

хлороформ

изоамиловый спирт

изопропанол этиловый спирт

уксусная кислота, агароза, этидиум бромид, бромфеноловый синий, ксиленцианол, глицерин, лизоцим, РНКаза, протеиназа К, ДНК-маркер - ДНК фага лямбда/EcoRI + HindIII маркер («Fermentas», Литва).

Набор «Амплификация»: 10×ПЦР буфер, 2,5 mМ ΣdNTPs, 50 mМ MgCl2, фермент Taq-полимераза (5 ед./мкл), минеральное масло (Компания «Dialat Ltd», Россия); набор для выделения фрагментов из агарозного геля QIAquick Gel Extraction Kit (фирма «Qiagen»).

5.3.1.2. Ход определения

1. Условия выращивания. Культуру бифидобактерий выращивают в высоких пробирках с 20 мл бульона в анаэростате в течение 48 ч при 37 °С.

2. Выделение геномной ДНК из Bifidobacterium. На данной стадии проведения анализа проба подвергается специальной обработке, в результате которой происходит лизис клеточного материала, удаление белковых и полисахаридных фракций, и получение раствора ДНК или РНК, свободной от ингибиторов и готовой для дальнейшей амплификации. Выбор методики выделения ДНК (РНК) в основном определяется характером обрабатываемого материала. За основу взят метод выделения ДНК из клеток бифидобактерий Regnault В. et al. [5]; модифицированный метод разработан в лаборатории генетики микроорганизмов Института общей генетики им. Н.И. Вавилова РАН.

Методика выделения. Культуру бактерий центрифугировать при 8000 об/мин в течение 10 мин. Осадок суспендировать в 0,6 мл буфера TEST (трис НСl pH 8,0 10 mМ; ЭДТА pH 8,0 5 mM; NaCl 1М; Тритон-X100 1/200 объема). Осторожно перемешать. Инкубировать при 37 °С в течение 12 ч. Добавить 150 мкл свежеприготовленного раствора лизоцима (исходная концентрация 100 мг/мл); добавить 10 мкл раствора РНКазы (исходный раствор 10 мг/мл). Осторожно перемешать. Инкубировать при 37 °С в течение 3 ч (суспензия должна стать слегка вязкой). Добавить 150 мкл раствора протеиназы К (исходный раствор 20 мг/мл) и 150 мкл 10 % саркозила. Осторожно перемешать. Инкубировать при 37 °С в течение 24 ч до полного лизиса. Добавить 100 мкл 25 % додецилсульфата натрия, перемешать, инкубировать при 55 °С в течение 2,5 ч (суспензия должна посветлеть). Очистку ДНК следует проводить в эппендорфах объемом 2 мл. К лизату клеток добавить 1 объем фенола (свежеперегнанный фенол предварительно насытить сначала трис НСl pH 8,0 1М, а затем трис НСl pH 8,0 0,1М, добавить оксихинолин). Содержимое эппендорфа интенсивно, но осторожно перемещать переворачиванием в течение 1 мин. Центрифугировать 10 мин при 12000 об./мин. Водную фазу отобрать в новый эппендорф, обработку фенолом повторить. Водную фазу отобрать в чистый эппендорф и добавить 1 объем хлороформа с изоамиловым спиртом (24 хлороформа: 1 изоамилового спирта). Содержимое эппендорфа перемещать переворачиванием в течение 1 мин. Центрифугировать 5 мин при 12000 об./мин. Водную фазу перенести в чистый эппендорф, добавить 1 мл изопропанола, перемешать переворачиванием (появится осадок в виде тяжей). Центрифугировать в течение 1 мин при 10000 об./мин, удалить супернатант. Осадок промыть 70 % этиловым спиртом, высушить и растворить в 150 мкл воды.

Учет результатов. Результаты исследования учитываются путем анализа исследуемых образцов методом электрофореза в агарозном геле.

3. Амплификация ДНК методом полимеразной цепной реакции (ПЦР). Метод основан на многократном избирательном копировании определённого участка ДНК при помощи ферментов в искусственных условиях (in vitro) [6]. При этом происходит копирование только того участка, который удовлетворяет заданным условиям, и только в том случае, если он присутствует в исследуемом образце. ПЦР позволяет найти в исследуемом клиническом материале небольшой участок генетической информации (несколько десятков пар нуклеотидов ДНК или РНК) любого организма, содержащийся в следовых количествах среди огромного количества нуклеотидных последовательностей иной природы, и быстро размножить его. По сути дела метод ПЦР имитирует в пробирке естественную репликацию ДНК, только повторяющуюся с огромной скоростью и столько раз, сколько это необходимо исследователю. Специфичность ПЦР основана на образовании комплементарных комплексов между матрицей и праймерами - короткими синтетическими олигонуклеотидами длиной 18 - 30 оснований. Каждый из праймеров комплементарен одной из цепей двухцепочечной матрицы, обрамляя начало и конец амплифицируемого участка. После гибридизации матрицы с праймером (отжиг), последний служит затравкой для ДНК-полимеразы при синтезе комплементарной цепи матрицы. Важнейшая характеристика праймеров - температура плавления (Тm) комплекса праймер-матрица. Она определяется, как температура, при которой праймер присоединился к половине возможных сайтов связывания. Тm можно приблизительно определить по формуле

Tm = 2(nA + nT) + 4(nG + nC), где

nX - количество нуклеотидов X в праймере. Если праймер короткий и Тm мала, то праймер может оказаться частично комплементарен другим участкам матричной ДНК, что может привести к появлению неспецифических продуктов. Верхний предел температуры плавления ограничен оптимумом температуры действия полимеразы, активность которой падает при температурах выше 80 °С.

Обычно при проведении ПЦР выполняется 20 - 35 циклов, каждый из которых состоит из трех стадий: 1. Денатурация. Двухцепочечную ДНК-матрицу нагревают до 94 - 96 °С (или до 98 °С, если используется особенно термостабильная полимераза) на 0,5 - 2 мин, чтобы цепи ДНК разошлись. 2. Отжиг. Когда цепи разошлись, температуру понижают, чтобы праймеры могли связаться с одноцепочечной матрицей. Эта стадия называется отжигом. Температура отжига зависит от состава праймеров и обычно выбирается на 4 - 5 °С ниже их температуры плавления.

Время стадии - 0,5 - 2 мин. 3. Элонгация. ДНК-полимераза реплицирует матричную цепь, используя праймер в качестве затравки. Это - стадия элонгации. Полимераза начинает синтез второй цепи от 3ʹ-конца праймера, который связался с матрицей, и движется вдоль матрицы. Температура элонгации зависит от полимеразы. Часто используемые полимеразы Taq и Pfu наиболее активны при 72 °С. Время элонгации зависит как от типа ДНК-полимеразы, так и от длины амплифицируемого фрагмента. Обычно время элонгации принимают равным одной минуте на каждую тысячу пар оснований. После окончания всех циклов часто проводят дополнительную стадию финальной элонгации, чтобы достроить все одноцепочечные фрагменты. Эта стадия длится 7 - 10 мин.

Подготовка к анализу. Состав смеси для ПЦР (на 100 мкл): 10 мкл 10×ПЦР буфера, 10 мкл смеси 2,5 mM ΣdNTPs, 4 мкл 50 mМ MgCl2, 300 нг геномной ДНК и 0,8 мкл фермента Tag-полимеразы. Олигонуклеотидные праймеры добавляют в концентрации 20 пмоль на 100 мкл смеси.

Проведение исследования. Параметры ПЦР реакции: денатурация геномной ДНК при 95 °С в течение 5 мин; затем 30 циклов амплификации: 94 °С в течение 1 мин (денатурация), 56 - 58 - 60 °С (в зависимости от праймеров) в течение 1 мин (отжиг олигонуклеотидов), 72 °С в течение 2 мин (достройка (элонгация) цепи); финальная элонгация фрагментов при 72 °С в течение 10 мин, хранение при 4 °С.

4. Праймеры, используемые для идентификации рода и вида бифидобактерий приведены в табл. 1 и 2.

Таблица 1

Название рода, вида

Название олигонуклеотида

Структура олигонуклеотида 5ʹ - 3ʹ

Ожидаемый размер ПЦР фрагмента, нуклеотиды

1

2

3

4

Bifidobacterium

g-Bifid-1

CTCCTGGAAACGGGTGG

549 - 563

g-Bifid-2

GGTGTTCTTCCCGATATCTACA

В. adolescentis

BiADOg-1a-1

CTCCAGTTGGATGCATGTC

279

BiADOg-1b-1

TCCAGTTGACCGCATGGT

BiADO-2

CGAAGGCTTGCTCCCAGT

В. angulatum

BiANG-1

CAGTCCATCGCATGGTGGT

275

BiANG-2

GAAGGCTTGCTCCCCAAC

В. breve

BiBRE-1

CCGGATGCTCCATCACAC

288

BiBRE-2

ACAAAGTGCCTTGCTCCCT

В. catenulatum

BiCATg-1

CGGATGCTCCGACTCCT

285

BiCATg-2

CGAAGGCTTGCTCCCGAT

B. bifidum

BiBIF-1

CCACATGATCGCATGTGATTG

278

BiBIF-2

CCGAAGGCTTGCTCCCAAA

В. infantis

BiINF-1

TTCCAGTTGATCGCATGGTC

828

BiINF-2

GGAAACCCCATCTCTGGGAT

В. longum

BiLON-1

TTCCAGTTGATCGCATGGTC

831

BiLON-2

GGGAAGCCGTATCTCTACGA

Таблица 2

Название олигонуклеотида

Структура олигонуклеотида 5ʹ - 3ʹ

Ожидаемый размер фрагмента, нуклеотиды

Для амплификации генов 16S рРНК

 

16SN

GTGGAGGGTTCGATTCTGGCT

1550

16SC

AGAAAGGAGGTGATCCAGCCG

Для амплификации генов β-субъединиц F0F1 АТФаз

 

BLβN

ATGGCTGACAACCAGACCACT

1550

BLβC

TCACGCACCCAGTTCCTTCTG

Для амплификации гена трансальдолазы

 

BtalFor

CGTCGCCTTCTTCTTCGTCTC

301

BtalRev

CTTCTCCGGCATGGTGTTGAC

5. Визуализация результатов методом электрофореза в агарозном геле. Результаты исследования учитываются путем анализа продуктов амплификации исследуемых образцов методом электрофореза в агарозном геле. В результате амплификаций должны быть наработаны фрагменты, соответствующие размерам, указанным в табл. 1 и 2.

Для разделения фрагментов ДНК по размеру (длине) применяют метод ДНК-электрофореза в агарозном геле [7]. Силы электрического поля, прикладываемого к образцам, заставляют фрагменты ДНК мигрировать через гель. Сахарофосфатный остов молекул ДНК заряжен отрицательно и поэтому цепи ДНК двигаются от катода, заряженного отрицательно, к положительному аноду. Более длинные молекулы мигрируют медленнее, так как задерживаются в геле, более короткие молекулы двигаются быстрее. После разделения (краситель вносят в расплавленную агарозу) фрагменты ДНК разной длины визуализируют при помощи флюоресцентных красителей, специфично взаимодействующих с ДНК, например, агарозные гели обычно красят бромистым этидием, который интеркалирует между азотистыми основаниями дуплекса и флюоресцирует в УФ-лучах. Определение размеров производят путем сравнения полученных фрагментов с коммерчески доступными препаратами ДНК (ДНК-маркерами), содержащими линейные фрагменты ДНК известной длины.

Подготовка к анализу

А. Приготовление агарозного геля: 0,8 - 2,0 %-ю суспензию агарозы в буфере для электрофореза доводят до кипения и охлаждают до 45 °С, добавляют этидиум бромид до концентрации 0,5 мкг/мл. Заливают в специальную форму с гребёнкой и дают затвердеть, гребёнку осторожно вынимают и форму с гелем переносят в аппарат для горизонтального электрофореза и погружают в буфер.

Б. Приготовление 1 л 10-кратного ТАЕ буфера для электрофореза: навеску 4,04 г Трис растворяют в 200 мл дистиллированной воды, добавляют 1,14 мл ледяной уксусной кислоты и 2 мл 0,5М раствора ЭДТА pH 8,0 и доводят объём буфера до 1000 мл дистиллированной водой. Для проведения электрофореза 10-кратный ТАЕ буфер разводят дистиллированной водой в 10 раз.

Проведение исследования

В пробирки с исследуемыми образцами после завершения амплификации вносят аккуратно под масло 1/5 объема раствора, содержащего 0,25 % раствора бромфенолового синего и 0,25 % раствора ксиленцианола в 50 %-м глицерине, перемешивают наконечником для пипеточных дозаторов и 8 мкл полученного образца вносят в лунки агарозного геля, образовавшиеся от зубцов гребёнки. Электрофорез проводят при напряжении 120 вольт в течение 60 мин. За это время краситель успевает пройти не менее половины геля.

Учет результатов электрофореза. Результаты электрофореза учитывают в ультрафиолетовом свете с длинной волны 254 нм на приборе «Трансиллюминатор». Результаты реакции выявляются в виде светящихся красноватых полос. Положительными считаются пробы, содержащие фрагменты необходимой длины (1550 нуклеотидов).

6. Выделение и очистка амплифицированной ДНК. Проводят с использованием наборов для выделения фрагментов из агарозного геля (типа QIAguick Gel Extraction Kit фирмы «Qiagen»), согласно протоколу изготовителя.

7. Определение нуклеотидных последовательностей генов 16S рРНК, трансальдолазы и β-субъединицы F0F1 АТФазы. Проводят по методу Сэнгера [8].

Анализ таксономической принадлежности бифидобактерий проводят с использованием компьютерной программы Blast (http://www.ncbi.nlm.nih.gov/blast). Для сравнения последовательностей генов рибосомальных РНК у бифидобактерий используют последовательности этого гена, характерные для разных видов Bifidobacterium, депонированные в GenBank NCBI. Сравнение последовательностей проводят с использованием программы ClustalW (http://www.ch.embnet.org/software/ClustalW.html).

5.3.2. Методика молекулярно-генетического анализа таксономической
принадлежности лактобактерий

5.3.2.1. Сравнительный анализ нуклеотидных последовательностей генов 16S рРНК для идентификации видовой принадлежности Lactobacillus spp.

Сущность метода. Секвенированием ДНК называют комплекс методов, позволяющих определить нуклеотидную последовательность ДНК или ее фрагментов. Для идентификации и классификации бактерий определяют нуклеотидную последовательность наиболее консервативных участков бактериального генома. Изучение полных нуклеотидных последовательностей отдельных генов дает дополнительную информацию об эволюции таксона. Родственные представители обычно обладают гомологичными по последовательности генами. Поэтому на данный момент таксономия базируется в основном на данных секвенирования малой субъединицы рРНК, как наиболее информационном виде анализа (Ботина и др., 2005, 2007).

5.3.2.2. Оборудование, материалы, лабораторная посуда, реактивы.

А. Реактивы:

50 мМ Трис - НСl

10 мМ ЭДТА - Na2

хлороформ

лизоцим

РНКаза

10 % SDS

5М NaCl

фенол

изопропанол деионизированная вода

Taq-полимераза

праймеры (фирма «Синтол»)

агароза

Б. Оборудование:

термостатный бокс для выращивания микроорганизмов

центрифуга

центрифуга вортекс

водяная баня

амплификатор Оmn-Е фирмы Hybaid

камера для электрофореза.

5.3.2.3. Выделение ДНК

Выращивание всех штаммов лактобактерий проводят в жидкой стандартной среде МРС при 37 °С в течение 24 - 48 ч.

Клетки из 14 мл культуры осаждают центрифугированием при 4400 g в течении 12 мин и ресуспендируют в 7 мл буфера 50 мМ Трис-НСl, 10 мМ ЭДТА-Na2, pH 8,0. Суспензию клеток центрифугируют в тех же условиях и осадок ресуспендируют в 500 мкл указанного выше буфера; суспензию переносят в 2-мл центрифужную пробирку и добавляют 50 мкл хлороформа. Смесь энергично встряхивают с помощью вортекса (5 раз по 10 сек), вносят 100 мкл лизоцима (60 мг/мл) и инкубируют 30 мин при 37 °С; затем добавляют 6 мкл РНКазы А (10 мг/мл) и инкубируют еще 30 мин при 37 °С. Для лизиса клеток суспензию мягко смешивают с 200 мкл 10 % ДСН (SDS) и 200 мкл 5М NaCl; смесь инкубируют 16 ч при 65 °С. Полученный грубый лизат клеток остужают до комнатной температуры, добавляют 1 мл смеси фенол/хлороформ (1:1) и тщательно смешивают в течение 5 мин до состояния гомогенной эмульсии; смесь центрифугируют при 12000 g 15 мин. Водную фазу, содержащую ДНК, отбирают в новую 1,5-мл пробирку и смешивают с 600 мкл изопропанола. Смесь инкубируют 30 мин при комнатной температуре и центрифугируют при 12000 g 20 мин. Осадок ДНК трижды промывают порциями по 0,5 мл 75 %-го этанола (центрифугирование по 5 мин при 12000 g) и растворяют в 100 мкл деионизованной воды. ДНК хранят при -20 °С.

5.3.2.4. Анализ 16S рибосомной нуклеиновой кислоты.

1. Полимеразная цепная реакция (ПЦР)

Гены 16S рРНК амплифицируют с помощью ПЦР с использованием праймеров 27f (AGAGTTTGATCCTGGCTCAG) и 1492 г (GGTTACCTTGTTACGACTT) [Lane, 1991]. Каждую реакцию проводят в 50 мкл реакционной смеси, содержащей 0,5 мкг хромосомной ДНК, по 20 пмоль праймеров, 200 мкМ каждого dNTP, 1,5 мМ MgCl2, 50 мМ KCl, 10 мМ Tris-HCl (pH 8,8) и 1,25 единицы активности Taq-полимеразы. Реакцию проводят в амплификаторе Omn-E фирмы Hybaid. Сначала образцы ДНК подвергают денатурации при 94 °С в течение 5 мин. Затем проводят 35 циклов, включающих денатурацию ДНК при 94 °С в течение 30 с, отжиг праймеров при температуре 55 °С в течение 40 с и полимеразную реакцию в течение 1 мин. Заключительный этап элонгации проводят при 72 °С в течение 4 мин. Праймеры для ПЦР синтезируются по предварительному заказу в специализированном предприятии (ООО «Синтол», РФ).

2. Электрофорез ДНК в агарозном геле и выделение ДНК из геля

Гель-электрофорез ДНК проводят в горизонтальном 0,7 %-м агарозном геле в трис-ацетатном буфере при напряженности электрического поля 5 В/см, содержащем 0,5 мкг/мл бромистого этидия. Для определения размеров фрагментов ДНК в качестве стандартов используют ДНК-маркер типа GeneRuler™ DNA Ladder Mix SM0331 фирмы Fermentas.

Фрагменты ДНК выделяют из геля методом электроэлюции на полоску DEAE бумаги Serva. Бумагу вставляют перед полосой фрагмента в прорезь в геле и проводят электрофорез в течение 7 мин при 10 вольт/см. Бумагу со связавшейся с ней ДНК помещают в 500 мкл 2 М раствора NaCl и инкубируют 40 мин при 65 °С. После удаления бумаги ДНК осаждают из раствора 1 мл 96 % этанола. Осадок ДНК промывают 2 раза 70 % этанолом и растворяют в 40 мкл буфера ТЕ.

3. Секвенирование ДНК

Секвенирование фрагментов ДНК проводится в специализированном предприятии на базе Центра коллективного пользования «Геном» (Институт молекулярной биологии им. В.А. Энгельгардта РАН) с помощью набора реактивов ABI PRISM® BigDye™ Terminator v. 3.1 с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3730 Applied Biosystems.

4. Анализ нуклеотидных последовательностей генов 16S рРНК

С целью идентификации видовой принадлежности исследуемые последовательности ДНК анализирют на сходство с известными последовательностями генов 16S рРНК в базе данных GeneBank с помощью программы BLASTN (http://blast.ncbi.nlm.nih.gov/Blast.cgi) [Zhang et al., 2000].

Идентичность последовательностей устанавливают на основе статистической значимости совпадений последовательностей. Дополнительный анализ последовательностей проводят с помощью их выравнивания с использованием программы Clustal X (http://www.ebi.ас.uk/Tools/clustalw/index.html).

6. Методы исследования биологических свойств
пробиотических штаммов

Санитарно-эпидемиологическая оценка штаммов должна базироваться на обязательных характеристиках безопасности и потенциальных пробиотических свойств видов культур, указанных в п. 2.3 настоящих Методических указаний, а также на дополнительных характеристиках, получение которых является необходимым для определенных изучаемых микроорганизмов.

Дополнительное тестирование проводится в случаях, если:

а) штаммы относятся к видам, среди представителей которых известно о наличии болезнетворных для человека штаммов, б) - у штамма, наряду со способностью улучшать состав и биологическую активность микрофлоры ЖКТ или помимо таковой, предполагается наличие дополнительной (специфической) функциональной активности.

6.1. Основные методы исследования безопасности штаммов в
тестах in vitro

6.1.1. Определение фенотипического профиля
чувствительности/резистентности штамма к антимикробным

препаратам

Чувствительность/резистентность штаммов к антимикробным препаратам определяют диско-диффузионным методом (ДДМ) с наложением стандартных бумажных дисков, пропитанных антимикробными препаратами, на поверхность плотной среды и/или методом серийного разведения антибиотика в жидкой питательной среде. Метод основан на способности антимикробных препаратов, диффундирующих в питательную среду, угнетать рост микроорганизмов, посеянных на поверхности агара, вокруг дисков с образованием зон задержки роста, или подавлять рост микробов в жидкой среде с внесенными в неё различными концентрациями препаратов. В этом случае для характеристики чувствительности штаммов к антимикробным препаратам устанавливают минимальную ингибирующую концентрацию (МИК), при которой отсутствует видимый рост культуры. Эта концентрация определяет степень чувствительности штамма к антибиотику.

Для оценки следует использовать не менее 25 - 30 наименований из числа основных употребляемых в медицине групп антимикробных препаратов (пенициллины, цефалоспорины 1 и 3 поколений, карбапинемы, аминогликозиды 1, 2, 3 поколений, тетрациклины, макролиды, линкозамины, гликопептиды, полимиксины, хинолоны и фторхинолоны).

А. Тестирование бифидобактерий диско-диффузионным методом

Используют модифицированный в лаборатории биологии бифидобактерий ФГУН «Московский научно-исследовательский институт эпидемиологии и микробиологии им. Габричевского» диско-диффузионный метод на основе МУК 4.2.1890-04 «Определение чувствительности микроорганизмов к антибактериальным препаратам» и рекомендаций Национального Комитета Клинических Лабораторных Стандартов, NCCL, 2002 г., США. Используют диски с антибиотиками производства НИИЭМ им. Пастера (Россия, Санкт-Петербург).

Бактериальную культуру готовят общепринятым методом из лиофилизированного материала. Третью генерацию бульонной культуры из разведения 10-4 в количестве 0,1 мл наносят на поверхность агаризованной БС-среды для культивирования и выделения бифидобактерий производства НИИ прикладной микробиологии, г. Оболенск, разлитой в чашки Петри слоем не меньше 4 - 5 мм непосредственно перед постановкой опыта. Круговыми движениями шпателя быстро равномерно втирают материал в агаризованную среду, раскладывают антибиотики по трафарету (не более 5 дисков с антибиотиками на чашку), с учетом зон задержки роста культур для каждого из антибиотиков (зоны оценивали в предварительном эксперименте). Чашки помещают в анаэростаты с атмосферой, содержащей 10 % СO2, генерируемой газпаками фирмы Биомерье. Учет зон задержки роста бактериальной культуры проводят через 24 ч выращивания при (37,5 ± 1) °С.

Интерпретацию полученных результатов проводят при использовании пограничных значений чувствительности бифидобактерий, разделяющих их на три категории, установленных в табл. 2.

Таблица 2

Критерии интерпретации результатов для оценки чувствительности
бифидобактерий [по Жиленковой О.Г., Амерхановой А.М., 2009;
Назыровой Н.Р., 2008]

Препарат

Доза вещества в диске, мкг

Диаметр зоны ингибиции роста, мм, и категории чувствительности бифидобактерий

устойчивые

промежуточно устойчивые

чувствительные

1

2

3

4

5

Доксициклин

30

≤ 8 - 10

11 - 20

≥ 21

Полимиксин

300

≤ 8 - 10

11 - 20

≥ 21

Стрептомицин

10

≤ 16

17 - 19

≥ 20

Гентамицин

10

≤ 12

13 - 14

≥ 15

Тетрациклин

30

≤ 16

17 - 21

≥ 22

Ципрофлоксацин

5

≤ 15

16 - 20

≥ 21

Пенициллин

10

≤ 8 - 10

11 - 20

≥ 21

Цефалоспорин

30

≤ 8 - 10

11 - 20

≥ 21

Карбапинем

10

≤ 8 - 10

11 - 20

≥ 21

Линкомицин

15

≤ 8 - 10

11 - 20

≥ 21

Ванкомицин

30

≤ 8 - 10

11 - 20

≥ 21

Эритромицин

15

≤ 8 - 10

11 - 20

≥ 21

Хлорамфеникол

30

≤ 8 - 10

11 - 20

≥ 21

Имипенем

10

≤ 8 - 10

11 - 20

≥ 21

Ампициллин

10

≤ 8 - 10

11 - 20

≥ 21

Цефалотин

30

≤ 8 - 10

11 - 20

≥ 21

Б. Тестирование лактобактерий диско-диффузионным,методом

Используют агаризованную питательную среду МРС, которую вносят в чашки диаметром 90 мм в объеме 20 мл для достижения слоя агара (4,0 ± 0,5) мм.

Из тестируемых культур готовят суспензии, соответствующие по плотности оптическому стандарту мутности на 5 единиц (с содержанием микробных тел около 1,5 - 5×108 КОЕ/мл), которые наносят на поверхность агара по стандартной методике.

Диски с антимикробными препаратами наносят по 5 штук на поверхность агара через 15 мин после его инокуляции взвесью испытуемого штамма.

Инокулированные чашки с дисками инкубируют при температуре 35 °С в течение 18 - 24 ч, после чего измеряют диаметры зон задержки роста кронциркулем с точностью до 1 мм. Исследование осуществляют в трехкратной повторности, результаты выражают в виде средней арифметической.

Критерии интерпретации результатов для оценки чувствительности лактобактерий (пограничные значения зон торможения роста) приведены в табл. 3.

Таблица 3

Критерии интерпретации результатов для оценки чувствительности
лактобактерий по [Назыровой Н.Р. с соавт., 2008]

Препарат

Доза вещества в диске, мкг

Диаметр зоны ингибиции роста, мм, и категории чувствительности лактобактерий

устойчивые

промежуточно устойчивые

чувствительные

Доксициклин

30

≤ 8 - 10

11 - 20

≥ 21

Полимиксин

300

≤ 8 - 10

11 - 20

≥ 21

Стрептомицин

10

≤ 16

17 - 19

≥ 20

Гентамицин

10

≤ 12

13 - 14

≥ 15

Тетрациклин

30

≤ 16

17 - 21

≥ 22

Ципрофлоксацин

5

≤ 15

16 - 20

≥ 21

Пенициллин

10

≤ 8 - 10

11 - 20

≥ 21

Цефалоспорин

30

≤ 8 - 10

11 - 20

≥ 21

Карбапинем

10

≤ 8 - 10

11 - 20

≥ 21

Линкомицин

15

≤ 8 - 10

11 - 20

≥ 21

Ванкомицин

30

≤ 8 - 10

11 - 20

≥ 21

Эритромицин

15

≤ 8 - 10

11 - 20

≥ 21

Хлорамфеникол

30

≤ 8 - 10

11 - 20

≥ 21

Имипенем

10

≤ 8 - 10

11 - 20

≥ 21

Ампициллин

10

≤ 8 - 10

11 - 20

≥ 21

Цефалотин

30

≤ 8 - 10

11 - 20

≥ 21

В. Тестирование чувствительности бифидобактерий и лактобактерий методом серийных разведений.

Тестирование проводится в соответствии с методическим указаниями МУК 4.2.1890-04 «Определение чувствительности микроорганизмов к антибактериальным препаратам».

Постановка метода серийных разведений для оценки антибиотико-резистентности включает следующие этапы:

а) приготовление растворов антибиотиков;

б) приготовление питательных сред с растворами антибиотиков;

в) приготовление суспензии исследуемого штамма и контрольного штамма, стандартизация суспензии и инокуляция;

г) инкубация;

д) интерпретация результатов исследования.

Общими этапами в методе серийных разведений являются: приготовление растворов антибиотиков, питательных сред, смешивание растворов антибиотиков и питательных сред.

Приготовление растворов антибиотиков

Используют основные растворы антибиотиков (пригодные для хранения) и рабочие, используемые «ех tempore» для приготовления питательных сред.

Основные растворы антибиотиков готовят в концентрации 1000 мкг/мл и выше. Навески антибиотиков для приготовления основных растворов готовят с учетом их активности. Расчет навески антибиотика для приготовления основного раствора проводят по формуле:

Из основных растворов готовят рабочие двукратные концентрации антибиотиков. Для приготовления рабочих растворов используется стерильная дистиллированная вода. Расчет навески антибиотика для приготовления основного раствора в случае, если активность антибиотика измеряется в ЕД, производится аналогично.

Приготовление сред, содержащих антибиотики для серийных разведений

Наиболее предпочтительным для метода серийных разведений в бульоне при исследовании штаммов-пробиотиков является микрометод (в планшетах), для которого серийные разведения антимикробных препаратов делают не в дистиллированной воде, а в жидкой питательной среде. Жидкая питательная среда, прошедшая контроль качества, готовится в соответствии с инструкцией изготовителя.

При постановке методов серийных разведений проводят контроль роста культуры на среде без препарата, а качество среды и антибиотиков контролируют с использованием референтных штаммов данного вида. Контролируется также чистота суспензии микроорганизма, использованного для инокуляции, путем высева на неселективные среды.

Допускается использование готовых тест-систем для определения МИК, зарегистрированных в РФ в установленном порядке.

Учет результатов

Учет результатов при постановке микрометода проводят визуально по появлению видимой мутности или спектрофотометрически. За МИК принимают концентрацию, обеспечивающую полное подавление видимого роста.

Интерпретацию полученных результатов для лактобактерий проводят при использовании пограничных значений чувствительности, разделяющих их на три категории, приведенных в прилож. 2.

6.1.2. Определения отсутствия трансмиссивных генов
антибиотикорезистентности

6.1.2.1. Отсутствие у штамма генов, кодирующих трансмиссивную антибиотикорезистентность, дополнительно к фенотипическому профилю антибиотикорезистентности (в случае необходимости), устанавливается в соответствии с методикой, включенной в МУК 4.2.2305-07 «Определение генно-инженерно-модифицированных микроорганизмов и микроорганизмов, имеющих генно-инженерно-модифицированные аналоги, в пищевых продуктах методами полимеразной цепной реакции (ПЦР) в реальном времени и ПЦР с электрофоретической детекцией». Тестирование наличия последовательностей ДНК, кодирующих трансмиссивную устойчивость к медицинским и ветеринарным антибиотикам - ermC (к эритромицину, плазмиды рЕ194 Staphylococcus aureus), tetO (к тетрациклину, хромосомы Streptococcus pneumoniae), amp (к ампициллину, плазмиды pBR322 Esherichia coli), hph (к гигромицину, хромосомы Streptomyces hygroscopicus), sh blе (к блеомицину, хромосомы Streptomyces verticillus) проводится многокомпонентным набором праймеров производства НИИЭМ им. Гамалеи РАМН «ГМ-БАКТ-1» по ТУ 9398-001-01897357-08 по инструкции, прилагаемой к тест-системе.

Допускается для определения генов, кодирующих трансмиссивную антибиотикорезистентность у бифидобактерий, использовать праймеры согласно табл. 4.

Таблица 4

Праймеры для ПЦР-анализа бифидобактерий на наличие
генов устойчивости к антибиотикам

Название олигонуклеотида

Структура олигонуклеотида 5ʹ - 3ʹ

Ожидаемый размер ПЦР фрагмента, нуклеотиды

TetW-N

GATCGACCAGGCTGGCGTTG

250

TetW-C

GGCTGATTGGTTCTCCTGCG

Catl-N

ATGAACTTTAATAAAATTGATTTAGA

420

Catl-C

AGCATTTTTCAGGTATAGGTG

Егу-N

TATAGCTATTGAAAAGAGATAAG

705

Ery-C

ACACAGTCAAAACTTTATTACTTC

6.1.2.2. Гены, кодирующие трансмиссивную антибиотикорезистентность, могут также быть выявлены методом определения нуклеотидной последовательности ДНК штамма (секвенирование).

Нуклеотидную последовательность ДНК определяют по методу Sanger. Реакцию проводят по протоколу фирмы «Promega» в 3 стадии:

1. Радиомаркирование(кинирование) праймера.

Реакция кинирования праймера проходит в объеме 10 мкл в следующих условиях: 50 мМ Tris-HCl pH 7,5; 10 мМ MgCl2; 5 мМ DTT; 0,1 мМ спермидина; 10 pmol праймера; 10 рМ [γ32P]dATP; 5 ед. Т4-полинуклеотид киназы. Инкубировать 30 мин на 37 °С, затем активность фермента T4-Kinase останавливают повышением температуры до 90 °С в течение 2 мин.

2. Синтез меченых цепей методом ПЦР.

Кинированный праймер используется для синтеза методом ПЦР меченых 32Р цепей ДНК разной длины, терминированных случайным включением ddNTP. Реакция проводится в 17, 5 мкл в условиях: 50 мМ Tris-HCl, pH 9,0; 10 мМ MgCl2; 1,5 pmol кинированного праймера; 40 fmol матричной ДНК; 5 ед. Taq-полимеразы. В заранее подготовленные 4 пробирки, содержащие ddNTP, 50 мМ NaCl, раскапывают по 4 мкл реакционной смеси, сверху наслаивают вазелиновое масло и проводят амплификацию. Реакция проходит в следующих условиях: плавление цепей - 95 °С - 0,5 мин; отжиг затравок - 42 °С - 0,5 мин; элонгация цепей ДНК - 70 °С - 1 мин. Продолжительность амплификации составляет 30 циклов. Останавливают реакцию добавлением 4 мкл буфера для нанесения (95 % формамида, 20 мМ ЭДТА; 0,05 % бромфенолового синего и 0,05 % ксиленцианола FF).

3. Электрофорез.

Полученные образцы прогревают 2 мин при 70 °С и наносят на 6 %-й полиакриламидный денатурирующий гель. В каждый слот геля наносят по 3 мкл соответствующего образца. Электрофорез проводят при постоянном напряжении (25 - 30 V/cm) при температуре 55 °С. По окончании электрофореза проводят фиксирование геля в 10 %-й уксусной кислоте, затем гель сушат 30 мин на стекле при температуре 60 °С. Экспонирование с рентгеновской пленкой «Кодак» проводят в течение 15 - 48 ч при комнатной температуре.

Секвенирование генома испытуемого штамма сопоставляют с базой данных для референс-штаммов вида, используемых в пищевых продуктах, для выявления генов, кодирующих трансмиссивную антибиотико-резистентность.

6.1.3. Определение отсутствия (наличия) плазмидного материала

Сущность метода определения плазмидного материала, в т.ч. плазмид, кодирующих трансмиссивную антибиотикорезистентность, заключается в выделении плазмидного материала и визуализации результатов с использованием электрофореза в агарозном геле для определения наличия плазмидной ДНК и плазмид, кодирующих признаки устойчивости к антибиотикам.

Аппаратура, материалы, лабораторная посуда, реактивы,
инструменты, питательные среды, реагенты *

________

* Допускается использовать других аппаратуру, материалы, лабораторную посуду, реактивы, инструменты, питательные среды, реагенты с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Набор реагентов GeneJET™ для выделения плазмидной ДНК

Наконечники Omnitip до 300 мкл, 10×96 запасной блок

Микроцентрифужные пробирки 1,5 мл

Наконечники Omnitip до 200 мкл, 10×96 запасной блок

GeneRuler™ 100 + п.н. ДНК-маркер

10Х ТВЕ буфер для электрофореза

TopVision™ LE GQ агароза

Пипетка Research. Объем 0,5 - 10 мкл

Пипетка Research. Объем 2,0 - 20 мкл

Пипетка Research. Объем 10 - 100 мкл

Пипетки Research. Объем 20 - 200 мкл

Пипетка Research. Объем 100 - 1000 мкл

Источник питания Эльф-4

Весы Scout Pro, 120 г/0,001 г

Центрифуга/вортекс Микроспин

Камера, 170×120 мм

UV-cleaner box

Центрифуга MiniSpin plus

Система регистрации результатов электрофореза Gel Imager

Подготовка к анализу

Исследование должно проводиться в специально оборудованных помещениях, состоящих из комнаты для работы с микроорганизмами, ПЦР-оборудованного помещения для работы с препаратами ДНК и комнаты для постановки электрофореза и учета результатов. Не допускается проведение микробиологических этапов исследования, выделения ДНК, и анализа присутствия плазмидной ДНК в образцах в помещениях, не предназначенных для этих целей во избежание контаминации и неверной интерпретации результатов.

Методика выделения плазмидной ДНК обеспечивает получение низкоразмерной ДНК с высокой степенью чистоты из культур клеток бактерий. Для анализа используется набор типа К0503, основной составной частью которого является микроколонка, протекание жидкости через неё обеспечивается центрифугированием. Колонка содержит специальную мембрану на силикатной основе. Набор позволяет получить до 20 мкг высококопийной плазмидной ДНК за одно выделение. Оптимальный объем клеточной культуры, используемой на начальном этапе, и реальное количество выделяемой ДНК зависит от среды, применяемой для роста клеточной культуры, и количества копий плазмиды.

Проведение анализа:

1) Отбор и подготовка проб

Выращенная при оптимальной температуре инкубации культура исследуемого штамма бактерий анализируется на присутствие в составе плазмидной ДНК.

Процедура выделения ДНК производится с использованием описанного выше лабораторного оборудования и набора реагентов GeneJET™ для выделения плазмидной ДНК (Ферментас), строго в соответствии с прилагаемой инструкцией фирмы-производителя.

2) Принцип метода

Осажденные бактериальные клетки ресуспендируют и подвергают щелочному лизису в присутствии додецилсульфата натрия для высвобождения плазмидной ДНК. Полученный лизат нейтрализуют. Клеточный дебрис и додецилсульфат натрия удаляют центрифугированием. Раствор, содержащий плазмидную ДНК, наносят на мембрану микроколонки GeneJET™. Адсорбированную ДНК промывают для удаления примесей. Очищенную плазмиду элюируют небольшим объемом буфера или воды.

3) Применяемые растворы и материалы

- раствор для ресуспендирования бактериальных клеток (70 мл)

- раствор для щелочного лизиса клеток (70 мл)

- раствор для нейтрализации клеточного лизата (100 мл)

- концентрированный раствор для промывки плазмидной ДНК, адсорбированной на мембране (100 мл)

- рибонуклеаза А (700 мкл)

- буфер для элюирования плазмидной ДНК (30 мл)

- микроколонки GeneJET™ (250 штук).

Набор реагентов типа GeneJET™ может храниться при комнатной температуре (15 - 25 °С), если срок хранения не превышает 12 месяцев. При более длительном использовании рекомендуется хранить набор при 4 °С. Если в процессе хранения в растворах выпадает осадок, то его следует растворить прогреванием раствора при 37 °С. Перед использованием растворы охладить до 25 °С. Не рекомендуется интенсивно перемешивать раствор для щелочного лизиса клеток.

После добавления рибонуклеазы А раствор для ресуспендирования бактериальных клеток должен храниться при 4 °С и быть использован в течение 6 месяцев.

4) Ход определения

Все процедуры очистки должны выполняться при комнатной температуре. Центрифугирование проводится в настольной мини-центрифуге. Скорость вращения ротора должна превышать 12000 об./мин. Для выделения высококопийных плазмид достаточно использовать 1 - 5 мл культуры Е. coli, выращенной в среде LB. Для выделения низкокопийных плазмид следует использовать 10 мл культуральной жидкости.

Анализ осуществляется строго поэтапно:

1. Перед первым использованием набора добавить рибонуклеазу А к раствору для ресуспендирования бактериальных клеток и перемешать. Ресуспендировать осажденные клетки в 250 мкл этого раствора, перемешивая до исчезновения комков. Перенести клеточную суспензию в пробирку для микроцентрифугирования.

2. Добавить к клеточной суспензии 250 мкл раствора для щелочного лизиса клеток и перемешать, переворачивая пробирку 4 - 6 раз. Раствор должен стать вязким и слегка прозрачным. Нельзя перемешивать смесь на шейкере-встряхивателе типа «Vortex», так как это может способствовать разрушению хромосомной ДНК. Нельзя инкубировать смесь дольше 5 мин, чтобы избежать денатурации суперскрученной плазмидной ДНК.

3. Добавить к клеточному лизату 350 мкл раствора для нейтрализации, немедленно тщательно перемешать, переворачивая пробирку 4 - 6 раз.

4. Центрифугировать смесь 5 мин для осаждения клеточного дебриса и хромосомной ДНК.

5. Нанести полученный раствор на мембрану микроколонки GeneJET™.

6. Центрифугировать 1 мин. Удалить прошедший через мембрану раствор из пробирки и поместить микроколонку в ту же пробирку.

7. Перед первым использованием набора к концентрированному раствору для промывки плазмидной ДНК, адсорбированной на мембране (100 мл), добавить 170 мл 96 - 100 %-го этанола. 500 мкл полученного раствора нанести на мембрану микроколонки GeneJET™. Центрифугировать 30 - 60 с и удалить раствор, прошедший через мембрану. Поместить микроколонку в ту же пробирку.

8. Повторить процедуру промывки (стадия 7).

9. Удалить раствор, прошедший через мембрану. Центрифугировать микроколонку еще 1 мин для удаления раствора для промывки плазмидной ДНК. Эта операция необходима для того, чтобы избежать следовых количеств этанола в препарате ДНК.

10. Перенести микроколонку GeneJET™ в чистую пробирку на 1,5 мл (не включена в набор). Нанести 50 мкл буфера для элюирования плазмидной ДНК в центр мембраны. Нельзя касаться мембраны наконечником пипетки. Выдержать 2 мин и центрифугировать 2 мин. Дополнительное проведение стадии 10 с использованием буфера для элюирования или воды позволяет увеличить выход выделенной плазмидной ДНК на 10 - 20 %.

11. Удалить микроколонку и хранить выделенную плазмидную ДНК при -20 °С.

Электрофорез выделенной плазмидной ДНК проводится с использованием камеры для электрофореза SE-2 (Хеликон) строго в соответствии с прилагаемой к аппарату инструкцией фирмы производителя. Препарат выделенной ДНК наносится в лунки агарозного геля и разгоняется в электрическом поле в течение 45 мин при напряжении 15В\см.

При проведении электрофореза должны соблюдаться следующие требования:

- при проведении электрофореза температура буферного раствора не должна превышать 45 °С;

- необходимо менять буфер после 2 - 3 электрофорезов;

- не допускается контакт составных частей изделия с органическими растворителями;

- при подключении к блоку питания соблюдать полярность;

- перед заливкой геля в заливочное устройство раствор агарозы остужать до 60 °С.

5) Учет результатов

Учет результатов анализа проводится с использованием гель-документирующей системы типа Gel Imager-2 в строгом соответствии с прилагаемой инструкцией фирмы-производителя. В тех дорожках, где обнаруживается светящийся в УФ-свете фрагмент - присутствует плазмидная ДНК того штамма, чей образец наносился.

Система типа Gel Imager-2 предназначена для ввода в компьютер изображений люминесцирующих следов ДНК в гелях, окрашенных бромистым этидием. Изображение выводится непосредственно на компьютер. Сигнал изображения формируется ПЗС-камерой с ручной наводкой на резкость, диафрагмированием и 2-кратным плавным масштабированием. При работе не требуется дополнительного затемнения помещения. Программное обеспечение Gel-Imager поддерживает функции контрастирования, масштабирования, преобразования позитив/негатив, позволяет накапливать кадры в буфер приложения, что значительно поднимает соотношение сигнал/шум. Имеется возможность записи в файл, сжатия, ведения базы данных и печати на принтере полученных изображений.

Системные требования к компьютеру:

- Intel 166 MHz процессор (или выше);

- 200 МВ свободной памяти на жестком диске;

- не менее 16 MB RAM;

- Microsoft Windows 95(98)/ХР и выше;

- видеоадаптер, поддерживающий режим True Color (24 бит);

- PCI - слот;

- Microsoft Office 97(с компонентами DAO 3.5 для работы базы данных).

6) Интерпретация результатов

Положительным результатом, говорящем о присутствии плазмидной ДНК, служит наличие плазмидного материала в геле после проведения электрофореза, визуализации в УФ-свете и его фиксирования с использованием компьютерной системы гель-документирования. Длина фрагментов ДНК, полученных после электрофоретического разделения продуктов ПЦР, сопоставляется с низкоразмерными маркерами 16 - 500 п.н.

Требования безопасности

При осуществлении данного анализа должны соблюдаться требования, предъявляемые к исследовательской работе с микроорганизмами III - IV групп патогенности.

Раствор для щелочного лизиса клеток и раствор для нейтрализации клеточного лизата содержат вещества, вызывающие раздражение кожи. Работать с ними необходимо в перчатках.

6.1.4. Определение профиля органических продуктов
(кислот, биогенных аминов, аммиака, пероксида водорода),
продуцируемых штаммом

6.1.4.1. Определение карбоновых кислот.

Сущность метода

Органические кислоты определяют в условиях газовой хроматографии. Разделение органических кислот происходит в капиллярной колонке с метилсиликоновой привитой фазой HP-5ms фирмы Agillent technologies. Концентрацию веществ определяют по масс-спектрам, используя стандартную программу идентификации прибора, основанную на базе данных NIST.

Аппаратура, материалы и реактивы *

________

* Допускается использовать других аппаратуру, материалы и реактивы с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Хроматографическая система: инжектор ГХ-МС системы AG-5973D фирмы Agillent technologies (США), капиллярная колонка фирмы Agillent technologies длиной 25 м и внутренним диаметром 0,2 мм, масс-спектрометр - квадрупольный, с ионизацией электронами (70 эв), система для обработки хроматографических данных база данных NIST.

Подготовка к испытанию

Карбоновые, фенилкарбоновые кислоты и спирты экстрагируют из 1 мл подкисленной до pH = 2 культуральной жидкости эфиром. Эфир высушивали при температуре до 40 °С, а сухой остаток обрабатывают в 20 мкл (БСТФА) в течение 15 мин при 80 °С для получения триметилсилильных эфиров кислот и спиртов.

Проведение испытания

Реакционную смесь в количестве 2 мкл вводят в инжектор ГХ-МС системы AG-5973D фирмы Agillent technologies (США).

Пример анализа 1. Метаболиты микроорганизмов в образце объекта окружающей среды (болотной воде).

Для управления и обработки данных используют штатные программы приборов. Хроматографическое разделение пробы осуществляют на капиллярной колонке с метилсиликоновой привитой фазой HP-5ms фирмы Agillent technologies длиной 25 м и внутренним диаметром 0,2 мм. Масс-спектрометр - квадрупольный, с ионизацией электронами (70 эв) работа в режиме полного сканирования. Режим хроматографирования: 7 мин при 80 °С, далее программирование температуры до 250 °С. Вещества на хроматограмме определяют по масс-спектрам, используя стандартную программу идентификации прибора, основанную на базе данных NIST.

Площади пиков маркеров на масс-фрагментограммах интегрируют автоматически по заранее составленной программе. Для выборочного детектирования целевых минорных компонентов на превалирующем фоне биологической жидкости используют метод масс-хроматографии. Затем эти данные вводили в программу расчета, подготовленную в электронных таблицах EXCEL. Для количественного расчета в качестве внутреннего стандарта используют 3-дейтеро-тридекановую кислоту, D5 бензойную кислоту или бутилбензоат.

Пример анализа 2. Культуральная жидкость бифидобактерий в процессе хранения.

Полный список анализируемых карбоновых кислот и сопутствующих соединений кислой эфирной фракции

Вещество

1

2

1

D5 Бензойная кислота СТ (400ng)

2

Фенол

3

п-Крезол

4

Бензиловый спирт

5

Бензойная кислота

6

п-Гидрокси-бензойная кислота

7

2,4-Дигидрокси-бензойная кислота

8

3,4-Дигидрокси-бензойная кислота

9

Фенил-уксусная кислота

10

п-Гидроксифенил-уксусная кислота

11

2-Гидрокси-фенил-уксусная кислота

12

Фенил-пропионовая кислота

13

п-Гидроксифенил-пропионовая кислота

14

Цинамовая кислота (Ph-3:2)

15

п-Гидроксифенил-цинамовая кислота

16

Фенил-молочная кислота

17

п-Гидроксифенил-молочная кислота

18

Фенил-пировиноградная кислота

19

п-Гидроксифенил-пировиноградная кислота

20

N-Ацетил-тирозин

21

о-Гидроксифенил-уксусная кислота

22

п-Гидрокси-бензальдегид

23

1-Индол-уксусная кислота

24

3-Индол-уксусная кислота

25

Антраниловая кислота

26

Янтарная кислота

27

Фумаровая кислота

28

2-Кето-глутаровая кислота

29

2-Гидрокси-глутаровая кислота

30

2-Гидрокси-масляная кислота

31

Молочная кислота

32

2-Гидрокси-3-метил-бутановая кислота

33

2-Гидрокси-гексановая кислота

34

Яблочная кислота

35

Гомованилиновая кислота

36

Метилмалоновая кислота

37

Дигидрокси-уксусная кислота

38

Метилциклоундецен

39

Нонановая кислота

40

Декагидронафталин

41

Тетрадекан

42

Додеканол

43

Метоксициннамовая кислота

44

Лауриновая кислота

45

Миристиновая кислота

46

Пальмитолеиновая кислота

47

ПимелиноваяС7дкк кислота

48

Пальмитиновая кислота

49

Фталевая кислота

50

АзелаиноваяС9дкк кислота

51

СебациноваяС10дкк кислота

52

Стеариновая кислота

53

Эйкозанол(С20 спирт)

54

Эйкозановая кислота

55

Докозанол

56

Сквален

57

Ситостерол

58

Urs-12-en

59

Friedoolean-6-en

60

Лакостерилацетат

61

Fridoolean-4-en-3-on

62

Углеводороды

Примечание. Список расширяется при появлении новых веществ в пробах, так как масс-спектрометрический анализ позволяет идентифицировать новые соединения по их масс-спектру в базе данных NIST.

Требование техники безопасности

- Работы с концентрированными кислотами, щелочами и др. летучими веществами должны проводиться в вытяжном шкафу.

- Необходимо соблюдать требования техники безопасности при работе с электроприборами.

6.1.4.2. Упрощенный метод анализа органических кислот

Метод состоит из следующих этапов:

1. Пробоподготовка. Во флакон объемом 20 мл на аналитических весах отбирают объем культуральной жидкости, соответствующий навеске 500 мг и добавляют 20 мл дистиллированной воды. Для более лучшей экстракции пробы помещают сначала на шейкер, а затем в УЗ-баню. Затем пробы центрифугируют и отбирают 1 мл в пробирки-виалы для дальнейшего анализа на ВЭЖХ.

2. Приготовление фосфатного буфера для хроматографии. 0,10 г дигидрофосфата калия растворяют примерно в 80 мл бидистиллированной воды, добавляют ортофосфорную кислоту до pH 2,5 и доводят объем бидистиллированной водой до 100 мл, фильтруют через фильтр с размером пор 45 мкм.

3. Определение. Используется ВЭЖХ в сравнении со стандартами органических кислот в соответствии с Р 4.1.1672-03 «Руководство по методам контроля качества и безопасности биологически активных добавок к пище», Минздрав России, Москва 2004.

Приготовленную пробу помещают в термостат вместе со стандартом, при этом делают две параллельных постановки. Объём ввода 20 мкл. Длина волны 210 нм.

Подвижная фаза: 100 % элюирование фосфатным буфером (А). Колонка: Atlantis С18, 4,6×250 мм, 5 мкм; скорость потока - 0,9 мл/мин. Общее время анализа составляет 12 мин. Ошибка метода ±10 %.

6.1.4.3. Метод анализа биогенных аминов состоит из следующих этапов

1. Пробоподготовка. Штаммы выращивают на оптимальных для их роста питательных средах, при необходимости культивируют в пищевых субстратах, составляющих основу пробиотического продукта (молоко, соевое молоко).

Культуральную жидкость обрабатывают трихлоруксусной кислотой (ТХУ) при нагревании, доводя её концентрацию до 5 %, отбирают аликвоту, которую последовательно обрабатывают в соответствии с методикой определения содержания биогенных аминов (тирамина, кадаверина, путресцина, спермидина, спермина, гистамина), включающим в себя стадию получения дансил-производных биогенных аминов.

2. Определение. Проводят разделение дансил-производных методом ВЭЖХ в сравнении с вводимыми стандартами, согласно Р 4.1.1672-03 «Руководство по методам контроля качества и безопасности биологически активных добавок к пище», Минздрав России, Москва 2004, с. 222.

Подвижная фаза: 55 % гексан : 45 % этилацетат, колонка «Kromasil Sil» 4,6×250 мм, флуориметрический детектор, длина возбуждающего излучения 335 нм, длина волны эмиссии 470 нм.

Предел обнаружения 0,03 мг/кг для тирамина и 0,1 мг/кг для гистамина.

Работа проводится с использованием защитных средств и в вытяжном шкафу.

3. Для интерпретации используют контроль питательной среды (субстрата) без культуры (фон), вычитая полученные значения из значений для штамма.

6.1.4.4. Метод анализа аммиака и других продуктов разложения белка (индола, сероводорода)

Допускается проводить анализ качественным способом при культивировании штаммов, при этом об образовании газообразных побочных продуктов разложения белка (аммиак, индол, сероводород) судят по изменению цвета индикаторной бумаги, помещенной под пробку пробирки с исследуемой культурой.

Готовят индикаторную бумагу из нарезанной на полоски фильтровальной бумаги размером 3×10 мм, которую пропитывают следующими индикаторными растворами:

а) Индикаторная бумага на аммиак по методу Крупа: смешивают 2 мл 1 %-го водного раствора фуксина, приготовленного из насыщенного спиртового раствора, с 1 мл 3 %-й серной кислоты. После того как раствор приобретет бурую окраску, им пропитывают фильтровальную бумагу и высушивают. Бумага должна быть бесцветной или слегка желтой. Хранят бумагу в банке с притертой пробкой.

б) Индикаторная бумага на сероводород: полоски фильтровальной бумаги пропитывают раствором уксуснокислого свинца (в 100 мл дистиллированной воды 20 г уксуснокислого свинца и 1 г двууглекислой соды) и высушивают.

в) Индикаторная бумага на индол по Морелю: полоски фильтровальной бумаги пропитывают насыщенным водным раствором щавелевой кислоты и высушивают.

Для культивирования штаммов используют мясо-пептонный бульон на переваре Хоттингера, содержащий повышенное количество свободного триптофана.

В пробирки с бульоном вносят по 1 петле суточной исследуемой культуры, выросшей на чашках с МПА (среде МРС, среде БС).

Тотчас же после посева приготовленные полоски индикаторной бумаги помещают в пробирку так, чтобы они не касались питательной среды.

Посевы инкубируют в термостате при температуре (37 ± 1) °С в течение 24 - 48 ч. При образовании аммиака индикаторная бумага краснеет, сероводорода - чернеет, при выделении индола бумага приобретает сиреневый или малиновый цвет.

При постановке методов используют контроль реакции на среде без культуры, а качество среды и реагентов на полосках - контролируют с использованием референтных штаммов данного вида.

6.1.4.5. Продукция пероксида водорода

1. Сущность метода

При культивировании бактерий на питательной среде, содержащей фермент пероксидазу и индикатор на кислород, образование пероксида водорода бактериями определяется по специфическому окрашиванию колоний в синий цвет.

2. Перечень аппаратуры, материалов, лабораторной посуды, реактивов, инструментов, питательных сред, реагентов и т.п.

Аппаратура: автоклав, термостат (инкубатор), эксикатор.

Лабораторная посуда: чашки Петри, пробирки.

Реактивы: фермент пероксидаза хрена, тетраметилбензидин (бензидин).

Инструменты: бактериологическая петля, спиртовка.

3. Подготовка к анализу

Контрольные культуры микроорганизмов: Bifidobacterium bifidum 791, B. bifidum 1, B. longum B379M, B. longum 2C, L. acidophilus (helveticus ТШ) NK1.

Питательные среды. Для бифидобактерий - среда БС (ФГУП Государственный научный центр прикладной микробиологии, г. Оболенск); для лактобацилл - МРС (DifcoTM Lactobacilli MRS Agar, BD, USA).

В питательные среды предварительно вводятся: 5 мг тетраметилбензидина (бензидина) и 0,5 мг пероксидазы хрена на 20 мл агара.

Условия культивирования: для бифидобактерий - в анаэробных условиях с использованием анаэростата (BBL® USA) и газогенераторных пакетов GasPak Plus (BBL® USA). Лактобациллы выращиваются как в аэробных, так и в анаэробных условиях. Оптимальная температура культивирования 37 °С, время культивирования 24 - 48 ч.

4. Методика проведения исследования

1 этап - посев петлей исследуемой культуры методом штрихов на питательную среду, содержащую пероксидазу хрена и бензидин (тетраметилбензидин).

2 этап - культивирование лактобацилл при 37 °С в течение 24 - 48 ч в эксикаторе со свечей. Бифидобактерии культивируются в анаэростате.

3 этап - учет результатов: колонии, образующие пероксид водорода (Н2О2), синего цвета. Остальные колонии бесцветные.

5. Требования безопасности

Микробиологические исследования проводятся с соблюдением Санитарных правил по безопасности работ с микроорганизмами III - IV групп патогенности.

6.1.5. Определение способности к деконъюгации желчных солей

Устанавливается путем анализа на скорость роста штамма-кандидата в среде с добавлением пузырной желчи.

6.1.6. Определение способности к гидролизу муцина

Устанавливается но способности штамма деградировать in vitro муцин желудка свиньи или гликопротеины кишечника человеческого происхождения. Количество муцина в культуральной жидкости определяют спектрофотометрическим методом по разнице концентрации белка в исходной среде и надосадочной жидкости, образовавшейся после кислотного осаждения муцина. Для опыта используется две параллельных пробы - культуральной жидкости предварительно выращенного в среде с добавленным гликопротеином штамма и аналогичной питательной среды с добавленным гликопротеином без штамма.

Аппаратура, материалы и реактивы *

________

* Допускается использовать других аппаратуру, материалы и реактивы с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Фотоэлектроколориметр

 

Весы лабораторные 2 класса точности с наибольшим пределом взвешивания 200 г

ГОСТ 24104

Весы лабораторные 3 класса точности с наибольшим пределом взвешивания 500 г

ГОСТ 24104

Весы лабораторные 4 класса точности с наибольшим пределом взвешивания 500 г

ГОСТ 24104

Пробирки стеклянные с притертыми пробками диаметром 2 см, высотой 20 см

ГОСТ 25336

Колбы мерные 2-го класса точности вместимостью 100 - 1000 см3 с притертыми пробками

ГОСТ 1770

Воронки стеклянные диаметром 7 см

ГОСТ 25336

Цилиндры мерные 2-ого класса точности вместимостью 100, 250, 500, 1000 см3

ГОСТ 1770

Колбы конические вместимостью 150 см3

ГОСТ 25336

Пипетки 2-го класса точности вместимостью 1, 2, 5, 10, 20, 25 см3

ГОСТ 20292

Палочки стеклянные длиной 18 - 20 см Дозаторы вместимостью 10 см3 с погрешностью не более 1 %

 

Бумага фильтровальная лабораторная марки ФОБ

ГОСТ 12026

Вода дистиллированная

ГОСТ 6709

Препарат свиного гликопротеина (муцина)

 

Препарат гликопротеина (муцина) человека

 

Подготовка материалов

Готовят параллельно по две опытные пробы (культуральной жидкости с штаммом и культуральной жидкости без штамма), первая из которых содержит культуральный фильтрат и рабочий реагент, вторая - надосадочную жидкость культурального фильтрата и рабочий реагент; стандартную пробу, содержащую водный раствор гликопротеина концентрацией 0,25 г/л и рабочий реагент; и контрольную пробу, содержащую дистиллированную воду и рабочий реагент. Рабочий реагент получают смешиванием раствора бромфенолового синего в концентрации 1,2 г/л и буферного раствора (pH 3,0), содержащего 320 ммоль/л лимонной кислоты и 160 ммоль/л натрия фосфата в соотношении 2:23. Содержимое каждой пробы перемешивают, инкубируют 10 мин.

Ход определения

Определяют оптическую плотность опытных и стандартной проб против контрольной пробы при длине волны 620 нм. Концентрацию белка в фильтрате и надосадочной жидкости рассчитывают, г/л:

С = (ОПоп.:ОПст.)×0,25, где

ОПоп. - оптическая плотность опытной пробы;

ОПст. - оптическая плотность стандартной пробы.

За окончательный результат принимается разность значений концентрации белка в культуральной жидкости с штаммом и без штамма. Исследование проводится в трехкратной повторности. При получении статистически значимой разности в пользу штамма, последний признают способным к деградации муцина.

Требования безопасности

- Работы с концентрированными кислотами, щелочами и другими летучими веществами должны проводиться в вытяжном шкафу.

- Необходимо соблюдать требования техники безопасности при работе с электроприборами.

6.1.7. Определение способности пробиотических штаммов
ингибировать представителей нормофлоры кишечника in vitro

Определение взаимодействия пробиотических штаммов с представителями индигенной микрофлоры определяют одновременно двумя методами: перпендикулярных штрихов и путем натекания бляшек.

1. Сущность метода

При одновременном посеве исследуемой и тестовой культуры микроорганизмов путем перпендикулярных штрихов можно выявить их влияние друг на друга. При антагонизме через сутки совместного культивирования будут наблюдаться зоны задержки роста.

2. Перечень аппаратуры, материалов, лабораторной посуды, реактивов, инструментов, питательных сред, реагентов и т.п.

Аппаратура: автоклав, термостат (инкубатор), эксикатор со свечей, ультрафиолетовая лампа

Лабораторная посуда: чашки Петри, пробирки

Реактивы: 0,9 % раствор NaCl

Инструменты: бактериологическая петля, спиртовка.

3. Подготовка к анализу

Исследуемые культуры микроорганизмов: бифидобактерии и лактобациллы.

Тест-культуры: Lactobacillus acidophilus, выделенная из иммунобиопрепарата «Линекс» (Словения), производственный пробиотический штамм человеческого происхождения L. plantarum 8RA-3, музейные штаммы лактобацилл (№№ 7, 11, 12, 35, 39, 98, 291, 17, 32, 46) и энтерококков (№№ 16, 37, 42, 68), выделенных из полости рта и фекалий здоровых людей (музей кафедры микробиологии, вирусологии и иммунологии Тверской медицинской академии).

Питательные среды. Для бифидобактерий среда БС (ФГУП Государственный научный центр прикладной микробиологии, г. Оболенск); для лактобацилл - MPC (DifcoTM Lactobacilli MRS Agar, BD, USA).

Условия культивирования: для бифидобактерий - в анаэробных условиях с использованием анаэростата (BBL® USA) и газогенераторных пакетов GasPak Plus (BBL® USA). Лактобациллы выращиваются как в аэробных, так и в анаэробных условиях, а также в эксикаторе со свечей. Оптимальная температура культивирования 37 °С, время культивирования 24 - 48 ч.

4. Методика проведения исследования

1 этап. Посев перпендикулярными штрихами

Посев исследуемой культуры в виде штриха по диаметру на чашку с оптимальной питательной средой. Перпендикулярно первому посеву делаются штрихи других исследуемых микроорганизмов.

Посев методом совместного культивирования путем натекания бляшек одной культуры на другую

На питательную среду петлей наносят суточную бульонную культуру исследуемых микроорганизмов. После подсушивания рядом на расстоянии 0,5 см нанося петлей каплю другой исследуемой культуры так, чтобы вторая капля затекла на первую до середины и подсушивают.

2 этап. Культивирование при 37 °С в течение 24 - 48 ч.

3 этап. Учет результатов: измеряют зону задержки роста культур в мм.

Пример записи результатов для штаммов Bifidobacterium bifidum 791, В. bifidum 1, B. longum В379М, B. longum 2C, L. acidophilus (helveticus ТШ) NK1 приведен в табл. 5.

Таблица 5

Пример записи результатов изучения способности ингибиции
нормофлоры методом штрихов

№ п/п

Тестируемые культуры

Зоны задержки роста в мм

В. bifidum 791

В. bifidum 1

В. longum В379М

В. longum 2С

L. acidophilus (helveticus ТШ) NK1

1

2

3

4

5

6

7

1

Lactobacillus acidophilus (шт. Линекс)

0

0

0

0

0

2

L. plantarum 8RA-3

0

0

0

0

0

3

Lactobacillus acidophilus 7

0

0

0

0

0

4

L. acidophilus 11

0

0

0

0

0

5

L. acidophilus 12

0

0

0

0

0

6

L. acidophilus 35

0

0

0

0

0

7

L. acidophilus 39

0

0

0

0

0

8

L. acidophilus 98

0

0

0

0

0

9

L. acidophilus 291

0

0

0

0

0

10

L. acidophilus 17

0

0

0

0

0

11

L. acidophilus 32

0

0

0

0

0

12

L. acidophilus 46

0

0

0

0

0

13

Enterococcus faecalis 16

0

0

0

0

0

14

E. faecalis 37

0

0

0

0

0

15

E. faecalis 42

0

0

0

0

0

16

E. faecalis 68

0

0

0

0

0

5. Требования безопасности

Микробиологические исследования проводятся с соблюдением Санитарных правил безопасности работ с микроорганизмами III - IV групп патогенности.

6.1.8. Определение степени иммуномодуляции

6.1.8.1. Методы скрининга пробиотических штаммов в отношении их
иммуномодулирующей активности

Для оценки влияния производственно перспективных штаммов непосредственно на лимфоциты и на фагоциты, осуществляющие презентацию бактериального антигена лимфоцитам, используют модели in vitro 2 вариантов стимуляции лейкоцитов человека пробиотическими штаммами:

1. Прямая стимуляция лимфоцитов в культуре инактивированными бактериями:

- регистрация эффекта по продукции цитокинов ИФНγ, ИЛ-4, ИЛ-10, ИЛ-6, ФНОα;

- сравнение эффекта со стимуляцией ЛПС, ФГА и ФМА с иономицином;

- сравнение уровня продукции цитокинов лейкоцитами цельной крови и лимфоцитами, выделенными из нее.

2. Фагоцитоз исследуемых штаммов-пробиотиков:

- регистрация эффекта по продукции ИЛ-6, ИЛ-8, ФНОα;

- сравнение эффекта с эффектом, наблюдаемым при фагоцитозе S. aureus.

Степень и характер активации лимфоцитов и фагоцитов определяется по продукции ими провоспалительных и противовоспалительных цитокинов.

Выделение лимфоцитов из периферической крови человека

Лимфоциты выделяют центрифугированием в градиенте плотности. Гепаринизированную кровь, разведенную 1:1 фосфатно-солевым буфером (ФСБ) до объема 6 мл, наслаивают на 2 мл Immunoprep (d = 1,077) в центрифужной пробирке, центрифугируют при 400 g 20 мин.

Слой лимфоцитов (интерфазу) собирают пипеткой, отмывают средой RPMI 1640, центрифугируя 10 мин при 200 g. Рабочая взвесь лимфоцитов имеет концентрацию 2×106 в пулированной сыворотке человека.

Выделение нейтрофилов из периферической крови человека

Осадок лейкоцитов и эритроцитов, полученный на предыдущем этапе, доводят до исходного объема взятой крови и смешивают с 1/10 объема 10% желатина. Смесь инкубируют при 37 °С 30 мин для расслаивания на лейкоциты и эритроциты, затем собирают верхний слой, не содержащий эритроцитов, отмывают ФСБ, центрифугируя 10 мин при 200 g. Рабочая взвесь нейтрофилов имеет концентрацию 3×106 в пулированной сыворотке человека.

Контроль чистоты фракций на гематологическом анализаторе Micros АВХ60 показывает значения 90 - 95 % для лимфоцитов и нейтрофилов крови, полученных описанным методом.

Фагоцитоз пробиотических бактерий

200 мкл рабочей взвеси нейтрофилов и 100 мкл рабочей взвеси бактерий смешивают в центрифужной пробирке, и серию таких пробирок с разными штаммами бактерий или с лейкоцитами от разных доноров инкубируют при 37 °С 20 ч. Данный срок в ходе подготовительного этапа был определен как оптимальный для определения продукции ИЛ-6, ИЛ-8, ФНОα. По окончании инкубации пробирки центрифугируют 10 мин при 200 g, супернатант собирают для определения концентрации цитокинов, из осадков приготовляют мазки. При микроскопии мазков возможно оценить параметры фагоцитоза (%, фагоцитарное число). Продукцию цитокинов в процессе фагоцитоза следует соотносить со спонтанной продукцией нейтрофилами того же донора.

Стимуляция культуры лимфоцитов пробиотическими бактериями

В лунку 96-луночного культурального планшета вносят 140 мкл RPMI 1640 с гентамицином, 20 мкл рабочей взвеси лимфоцитов или цельной крови, 20 мкл стимулятора (рабочей взвеси бактерий или ФГА или ЛПС). Планшет инкубируют при 37 °С в инкубаторе СO2 от 24 до 96 ч.

По окончании этого срока супернатанты собирают, разливают порциями и хранят при -30 °С до исследования. Продукцию цитокинов, стимулированную пробиотическими штаммами, сравнивают с их спонтанной продукцией.

Для определения концентрации цитокинов (ИФНγ, ФНОα, ИЛ-4, ИЛ-10, ИЛ-6, ИЛ-8) методом ИФА используют тест-системы: ЗАО «Вектор-Бест» (Новосибирск), ООО «Цитокин» (Санкт-Петербург).

По спектру и интенсивности продукции цитокинов судят об иммуномодулирующих свойствах того или иного штамма.

6.1.8.2. Способность к стимуляции секреции цитокинов

Штаммы подвергают исследованию на их способность стимулировать секрецию цитокинов in vitro при стимуляции культуры периферических мононуклеарных клеток человека (hРВМС). Уровни цитокинов ИЛ-10, ИЛ-12, ТНФ альфа, интерферон гамма измеряют в ИФА в супернатантах штаммов, проинкубированных совместно с hРВМС 24 ч. Определение проводится в соответствии с прилагаемой инструкцией к тест-системам для ИФА.

Полученный профиль уровней цитокиновой активности устанавливается для минимально 3-х концентраций штаммов - 107, 108 и 5×109 КОЕ/мл питательной среды.

Исследование проводится с использованием референтных штаммов аналогичных видов в 5-кратной повторности.

Рассчитывается соотношение величин активности ИЛ-10 и ИЛ-12, по величине которого штаммы подразделяют на высоко активные - 90 - 110%, средние - 20 - 40 %, низкоактивные - 0 - 20 %. Активность выше 110 % является избыточной.

6.2. Основные методы исследования безопасности штаммов
в тестах in vivo

6.2.1. Определение способности к гидролизу мукозного слоя стенки
кишечника

Устанавливается по способности деградировать гликопротеины кишечника у крыс при кормлении (или интрагастральном введении) взвесью штамма с концентрацией клеток от 5×108 до 1011 КОЕ/мл(г).

Используется методика по п. 6.1.7 после предварительной подготовки кусочков слизистой оболочки слепой кишки крыс.

6.2.2. Способность к транслокации у иммунодефицитных животных

Проводится при использовании общепринятых методов посева внутренних органов (печень, селезёнка, лимфоузлы) иммунодефицитных лабораторных животных, получавших интрагастрально взвесь испытуемых штаммов по п. 6.3.2.1. Органы животных должны быть стерильны.

6.2.3. Изучение фагоцитарной активности штаммов

Фагоцитарную активность штаммов изучают, используя макрофаги периферической крови, или перитонеальные макрофаги.

Изучение проводится на элементах белой крови кроликов, белых мышей, реже морских свинок. Количество животных в группе определяется условиями эксперимента, но не должно быть менее 2 - 3 для крупных (кролики) и 6 для мелких животных.

Контролем служат интактные животные.

Сущность метода

Выращенные на плотной или жидкой питательной среде культуры штамма доводят стерильным физиологическим раствором по оптическому стандарту мутности до концентрации 1×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarlane (№ 1 - 7). Подготовленные взвеси хранят в холодильнике не более 3 сут, затем, в зависимости от условий эксперимента, готовят новые разведения культур.

Животным опытных групп ежедневно через иглу с наплавленной оливой вводят внутрижелудочно по 0,5 см3 взвеси с концентрацией клеток, зависящей от условий анализа. Длительность введения определяется предполагаемой длительностью потребления пробиотика. Контрольным животным в тех же объемах и в те же сроки выпаивают через иглу стерильный физиологический раствор.

Изучение фагоцитарной активности макрофагов периферической крови

По окончании исследований у животных опытных и контрольных групп проводят забор периферической крови - у кроликов из ушной вены, у мышей - из хвостовой. Если невозможен забор крови из периферической вены, животных наркотизируют эфиром и кровь берут методом декапитации. Для получения больших порций крови используют объединенные пробы.

Для предотвращения свертывания крови шприц и иглы для забора крови промывают гепарином с активностью 5 - 10 ед./мл или цитратом натрия (0,8 % раствор лимонно-кислого натрия). Края пробирки и саму пробирку смачивают гепарином или цитратом натрия.

Полученную кровь центрифугируют 10 мин при 150 g. На границе между осадком эритроцитов и плазмой отбирают тонкую белую прослойку, содержащую лейкоциты. Примесь эритроцитов можно разрушить добавлением 0,83 %-го раствора хлорида аммония. Клетки дважды отмывают изотоническим буферным раствором.

Отмытые клетки ресуспендируют в фосфатно-буферном растворе и подсчитывают их концентрацию в камере Горяева. Стерильным забуференным фосфатами физиологическим раствором доводят количество лейкоцитов до 2 - 4×106/мл.

Суточные культуры живых или убитых прогреванием при температуре (90 ± 2) °С микроорганизмов отмывают центрифугированием при 1500 об./мин 0,9 %-м раствором хлорида натрия. Концентрацию суспензии микробных клеток доводят по оптическому стандарту мутности до значения 10 ед.

В пробирки с коническим дном вносят по 2 мл взвеси лейкоцитов и 0,1 мл взвеси объектов фагоцитоза (микробные культуры). Смесь лейкоцитов с объектами фагоцитоза помещают в термостат при (37 ± 1) °С на 30 мин при встряхивании на шуттель-аппарате. По окончании сроков культивирования из пробирок готовят мазки, фиксируют метанолом или этанолом, окрашивают по Романовскому-Гимза и проводят микроскопию.

При учете результатов необходимо просмотреть под микроскопом не менее 200 клеток, подсчитывают фагоцитирующие клетки и количество микробов в одном макрофаге. Подсчитывают процент фагоцитирующих клеток (фагоцитарная активность, ФА), среднее число поглощенных частиц (фагоцитарный индекс, ФИ) и фагоцитарное число.

Допускается равные количества цитратной (0,8 % лимонно-кислого натрия) крови лабораторного животного и суспензии объектов фагоцитоза смешивать в пробирке, и смесь инкубировать при 37 °С в течение 30 мин, а затем готовить мазки, подсчитывая 25 нейтрофильных гранулоцитов в различных секциях препарата.

Определение макрофагальной активности на модели перитонеальных макрофагов

От забитых животных опытных и контрольных групп получают перитонеальный экссудат (ПЭ) путем 2 - 3-кратного промывания брюшной полости мышей средой 199, содержащей 5 ME гепарина в 1 мл. ПЭ собирают в центрифужные пробирки, стоящие на льду. После центрифугирования ПЭ при 150 g в течение 10 мин клетки ресуспендируют в фосфатно-буферном растворе. Концентрацию клеток доводят до 2 млн кл/мл и разливают по 2 мл в пробирки.

Суточные культуры живых или убитых прогреванием при температуре (90 ± 2) °С микроорганизмов отмывают центрифугированием 0,9 %-ным раствором хлорида натрия. Определяют концентрацию суспензии микробных клеток по стандарту оптической плотности, доводят стерильным физиологическим раствором или фосфатным буфером по оптическому стандарту мутности до значения 10 ед.

В пробирки с клетками ПЭ вносят 1 мл взвеси микроорганизмов и ставят в термостат при (37 ± 1) °С на 30 - 60 мин, после чего делают мазки, высушивают на воздухе, фиксируют метанолом, этанолом. Затем окрашивают азурэозином по Романовскому-Гимза. При учете результатов необходимо просмотреть под микроскопом не менее 200 клеток, подсчитывают фагоцитирующие клетки и количество микробов в одном макрофаге. Подсчитывают процент фагоцитирующих клеток и фагоцитарное число.

Контролем служат показатели фагоцитарной активности, установленные у контрольных животных.

Учет результатов

Оценивают фагоцитарный показатель (ФП) - процент фагоцитирующих клеток из общего числа макрофагов и фагоцитарное число (ФЧ) - среднее количество микробных частиц, поглощенных 1 активным макрофагом. Полученные по опытной группе данные сравнивают с результатами, полученными от контрольных животных и разницу выражают в процентах.

6.3. Дополнительные методы исследования безопасности штаммов

6.3.1. Тестирование in vitro

6.3.1.1. Определение гемолитической активности

Продукция гемолизинов считается фактором патогенности, в связи с чем продукция гемолизина во многих случаях является маркером вирулентности.

Определение гемолитической активности проводится на 5 %-м кровяном агаре. При продукции гемолизина через 18 - 24 ч при культивировании чашек Петри при оптимальной температуре развития гемолиза вокруг колоний образуется видимая зона гемолиза.

Аппаратура, материалы, лабораторная посуда, реактивы
и питательные среды, используемые для определения патогенных
свойств штамма и контрольного штамма аналогичного вида

Аппаратура и инструментарий *

________

* Допускается использовать других аппаратуру, материалы, реактивы и питательные среды с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке. Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29000. Питательные среды и препараты отечественного производства должны соответствовать нормативной документации, утвержденной в установленном порядке.

Анализатор потенциометрический, погрешность измерений PH ±0,01

ГОСТ 19881-74

Шкаф сушильный стерилизационный СС-80П или других марок, позволяющий поддерживать температуру (160 ± 5) °С

ТУ 64-1-28-70-76

Термостат, позволяющий поддерживать рабочую температуру 28 - 37 °С с отклонением от заданной ±1 °С

 

Баня водяная с подогревом

ГОСТ 12026-76

Весы лабораторные общего назначения, 2 и 4 класса точности, с наибольшим пределом взвешивания 200 г

ГОСТ 24104-88

Стерилизаторы паровые медицинские или аналогичные

ГОСТ 19569-89Е

Дистиллятор, обеспечивающий качество дистиллированной воды

ГОСТ 6709-72

Холодильник бытовой электрический

 

Микроцентрифуга типа «Эппендорф»

 

Пинцет медицинский

ГОСТ 21241-89

Ножницы медицинские

ГОСТ 21239-89

Скальпель хирургический, 15 см

ГОСТ 21240-89

Штативы для пробирок

 

Лабораторная посуда и материалы

Бумага фильтровальная лабораторная

ГОСТ 12026-76

Бутыли стеклянные для химических реактивов

 

Марля медицинская

ГОСТ 9412-77

Колбы плоскодонные конические или круглые разной вместимости

ГОСТ 1770-74

Воронки стеклянные

ГОСТ 25336-82

Вата медицинская гигроскопическая

ГОСТ 5556-81

Полистироловые планшеты U-образные

 

Пробирки типов П1, П2

ГОСТ 25336-82

Ступка фарфоровая с пестиком

ГОСТ 9147-80

Чашки биологические (Петри)

ГОСТ 23932-90

Микробиологические петли

 

Фломастеры-маркеры

 

Реактивы и питательные среды

Агар микробиологический

ГОСТ 17206-84

Вода дистиллированная

ГОСТ 6709-72

D-глюкоза, ч

ГОСТ 6038-79

D-манноза, хч

ТУ 6-09-22-98-79

Натрий фосфорно-кислый однозамещенный, ч

ГОСТ 4198-75

Натрий фосфорно-кислый двухзамещенный, хч

ГОСТ 2493-75

Кислота соляная, хч

ГОСТ 3118-77

Натрий хлористый, хч

ГОСТ 4328-77

Спирт этиловый ректификованный технический

ГОСТ 18300-87

Спирт этиловый ректификованный

ГОСТ Р 51652-2000

Экстракт дрожжевой

 

Триптон

 

Питательные среды для опытного и контрольных штаммов:

 

для определения мезофильных аэробных и факультативно-анаэробных микроорганизмов

ТУ 9229-083-00419785-97

для определения энтеробактерий

ТУ 9229-072-00419785-97

для определения дрожжей и микроскопических грибов (агар Сабуро, сывороточный и др.)

ТУ 9229-083-00419785-97

для определения S. aureus (типа Байрд-Паркера, солевой агар)

ГОСТ 10444.1, п. 5.1, п. 5.4

для выращивания бифидобактерий, молочно-кислых и пропионово-кислых бактерий (ГМС, М17, MRS)

ТУ 10-02-02-789-192-95

Дезинфицирующий раствор

 

Микробиологические петли

 

Стандарт мутности по McFarland

 

Оптический стандарт мутности 5 % взвесь эритроцитов человека, барана, кролика, морской свинки

ОСО 42-28-85П

Проведение анализа

Взвесь эритроцитов барана добавляют к охлажденной до 50 - 55 °С плотной питательной среде с таким расчетом, чтобы взвесь эритроцитов составляла в агаре 5 %.

Смесь аккуратно перемешивают и разливают в чашки Петри. После застывания агара и подсушивания чашек на поверхность 5 %-го кровяного агара высевают в разведениях культуру штамма для формирования отдельных колоний. После посева чашки инкубируют в зависимости от вида микроорганизма в течение 24 - 48 ч при оптимальной для него температуре развития. Затем чашки Петри вынимают из термостата и осуществляют учет результатов. При продукции гемолизина вокруг колоний формируются зоны гемолиза и тем большие, чем больше гемолизина продуцирует штамм.

При выявлении феномена продукции с колонии петлей осуществляют взятие материала, который высевают в пробирку с 3 мл обогащенной жидкой питательной среды (например, содержащую триптон, дрожжевой экстракт, аминокислоты).

Пробирки инкубируют в течение 24 - 48 ч при оптимальной температуре, после чего выращенные бактериальные клетки центрифугируют в центрифуге при 6000 об ./мин в течение 15 мин.

Супернатант аккуратно отбирают наконечником микропипетки и переносят в чистую пробирку. Затем готовят 1 %-ю взвесь эритроцитов барана или человека и разливают в пробирки по 1 см3 (макрометод) или в U-лунки планшет по 0,1 см3 (микрометод).

Добавляют равный объем супернатанта исследуемого штамма. Инкубируют в течение 1 ч при (35 - 37) °С и производят предварительный учет результатов. Окончательный учет результатов осуществляют через 18 - 24 ч инкубации смеси эритроцитов и супернатанта при температуре 18 - 20 °С.

При положительном результате наблюдается гемолиз эритроцитов, представляющий визуально окрашенный прозрачный бульон. Последняя пробирка или лунка, в которой наблюдается гемолиз, отражает титр (количество) гемолизина, продуцируемого штаммом. При отрицательном результате на дне пробирки или лунки формируется «пуговка» эритроцитов без изменения цвета бульона. Контроли: отрицательный - вместо супернатанта добавляется равный объем стерильного бульона, в котором проводилось выращивание культур; положительный - штамм гемолизпродуцирующей кишечной палочки, выращиваемый в тех же условиях.

6.3.2. Тестирование in vivo

6.3.2.1. Определение безвредности штаммов бифидобактерий и лактобацилл

Колонии 24-часовой культуры бифидобактерий или лактобацилл, выращенных на агаризованной МРС-среде, снимают с агара петлей, суспендируют в 0,5 мл 0,9 %-го раствора натрия хлорида до концентрации 100 млн/мл и выдерживают 30 мин при температуре (37 ± 1) °С. По 0,5 мл полученной взвеси вводят с помощью специальной насадки на шприц в желудок 5 белым мышам массой (15 ± 1) г. Наблюдения за мышами осуществляют в течение 5 суток.

В случае гибели за этот срок хотя бы одной мыши опыт повторяют на удвоенном количестве животных. Если в повторном опыте ни одна из мышей не погибнет, штамм считают безвредным. В противном случае штамм бракуется.

6.4. Основные методы исследования пробиотического
потенциала штаммов

6.4.1. Тестирование in vitro

6.4.1.1. Исследование антагонистической активности Bifidobacterium
spp., Lactobacillus spp. в отношении тест-культур патогенных
и условно-патогенных микроорганизмов различных групп методом
отсроченного антагонизма

Сущность метода

Сущность метода заключается в том, что при культивировании исследуемой культуры лактобацилл или бифидобактерий на питательной среде при оптимальных условиях в течение суток происходит выделение в среду антибактериальных факторов - комплексных продуктов, составной частью которых является белковый или полипептидный компонент, ответственный за бактерицидную активность. После ингибиции бактерий парами хлороформа наслаивают полужидкий агар с тестовыми культурами патогенных и условно-патогенных бактерий с последующей инкубацией при 37 °С 18 - 24 ч. Антибактериальные вещества задерживают рост тест-культуры и над бляшкой исследуемых микроорганизмов регистрируется прозрачная зона на фоне сплошного роста. Результаты оценивают по диаметру зоны задержки роста в мм.

Аппаратура, материалы, лабораторная посуда, реактивы,
инструменты, питательные среды, реагенты *

________

* Допускается использовать других аппаратуру, материалы, реактивы и питательные среды с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке. Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29000. Питательные среды и препараты отечественного производства должны соответствовать нормативной документации, утвержденной в установленном порядке.

Аппаратура: автоклав, термостат (инкубатор), водяная баня, ультрафиолетовая лампа

Лабораторная посуда: чашки Петри, пробирки

Реактивы: хлороформ

Инструменты: бактериологическая петля, спиртовка, пипетка-дозатор, наконечники

Тест-штаммы: S. aureus АТСС 25923, В. subtilis 534, Е. coli АТСС 25922, Sh. sonnei I фазы 941, Р. aeruginosa АТСС 27853, Klebsiella pneumoniae K1 5054, C. albicans АТСС 885-653.

Питательные среды:

Для бифидобактерий - среда БС (ФГУП Государственный научный центр прикладной микробиологии, г. Оболенск);

Для лактобацилл - МРС (Difco™ Lactobacilli MRS Agar, BD, USA).

Подготовка к анализу

Условия культивирования: для бифидобактерий - в анаэробных условиях с использованием анаэростата (BBL® USA) и газогенераторных пакетов GasPak Plus (BBL® USA). Лактобациллы выращиваются как в аэробных, так и в анаэробных условиях. Оптимальная температура культивирования 37 °С, время культивирования 24 - 48 ч.

Ход определения

1 этап. Посев исследуемых культур бляшками размером не более 10 мм, не более трех бляшек на чашку с оптимальной питательной средой.

2 этап. Культивирование при 37 °С в течение 18 - 24 ч.

3 этап: А. Ингибиция выращенных культур парами хлороформа или УФ-лучами 30 мин;

Б. В полужидкий 0,7 %-й МПА при температуре 50 °С вносится 1 мл суспензии тест-культуры, размешивается и наслаивается на выращенные в виде бляшек и убитые исследуемые культуры.

В. Через 15 - 20 мин после кристаллизации полужидкого агара чашки переворачивают и культивируют 18 - 24 ч при температуре 37 °С. Учет результатов

Измеряют диаметр зоны задержки роста тестовой культуры кронциркулем в мм.

Пример записи результатов испытаний антагонизма приведен в табл. 6.

Таблица 6

Запись результатов определения антагонизма

№ п/п

Исследуемые культуры

Зоны подавления роста тест-культур в мм

S. aureus АТСС 25923

B. subtilis 534

E. coli АТСС 25922

Sh. sonnei I фазы 941

P. aeruginosa ATCC 27853

Klebsiella pneumoniae K15054

C. albicans ATCC 885-653

1

B. bifidum 791

20

10

12

23

27

20

0

2

B. bifidum 1

20

30

28

26

28

22

6

3

B. longum В379М

25

23

26

26

23

21

6

4

B. longum 2C

20

26

30

24

28

21

6

5

L. acidophilus (helveticus ТШ) NK1

20

> 80

36

> 80

> 80

50

0

Интерпретация результатов

За положительный результат (наличие антагонистической активности) принимается размер зоны задержки роста 20 мм.

Требования безопасности

Микробиологические исследования проводятся с соблюдением Санитарных правил по безопасности работ с микроорганизмами III - IV групп патогенности.

6.4.1.2. Определение антагонистической активности штаммов к тест-
культурам энтеропатогенных микроорганизмов

Аппаратура, материалы, лабораторная посуда, реактивы
и питательные среды *

________

* Допускается использовать другие аппаратуру, материалы, реактивы, диагностические тест-системы и питательные среды с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Аппаратура и инструментарий

Анализатор потенциометрический, погрешность измерений pH ±0,01

ГОСТ 19881-74

Баня водяная с подогревом

ГОСТ 12026-76

Весы лабораторные общего назначения 2 и 4 класса точности, с наибольшим пределом взвешивания 200 г

ГОСТ 24104-88

Горелка спиртовая

ГОСТ 25336

Дистиллятор, обеспечивающий качество дистиллированной воды

ГОСТ 6709-72

Микроволновая печь для быстрого плавления плотных питательных сред

 

Микроскоп биологический МБИ-2, МБИ-3, МБР-3

ГОСТ 8284-78

Облучатель бактерицидный настенный ОБН-150 или других видов

ТУ 16-535-84

Смеситель лабораторный или ступка фарфоровая

ГОСТ 9147

Стерилизаторы паровые медицинские или аналогичные

ГОСТ 19569-89Е

Термостат, позволяющий поддерживать рабочую температуру (28 - 37) °С отклонением от заданной ±1 °С

 

Холодильник бытовой электрический

 

Шкаф сушильный стерилизационный ШСС-80П или других марок, позволяющий поддерживать температуру (160 ± 5) °С

ТУ 64-1-28-70-

Лабораторная посуда и материалы

Бумага фильтровальная лабораторная

ГОСТ 12026-76

Вата медицинская гигроскопическая

ГОСТ 5556-81

Воронки стеклянные

ГОСТ 25336-82

Колбы мерные, пробирки

ГОСТ 25336

Колбы плоскодонные конические или круглые разной вместимости

ГОСТ 1770-74

Марля медицинская

ГОСТ 9412-77

Микробиологические петли

 

Ножницы, скальпель, пинцет

ГОСТ 21241

Пипетки вместимостью от 1 до 10 см3

ГОСТ 29227-91

Полистироловые планшеты U-образные

 

Посуда лабораторная стеклянная

 

Пипетки градуированные

 

Часть 1. Общие требования Приборы мерные лабораторные стеклянные.

ГОСТ 29227-91

Бюретки, пипетки. Технические условия

ГОСТ 29162-92

Стекла предметные

ГОСТ 9284

Термометр ртутный с диапазоном измерения от 0 до 100 °С (цена деления шкалы 1 °С)

 

Холодильник бытовой

 

Чашки биологические (Петри)

ГОСТ 23932-90

Стандартный образец мутности на 10 ед.

ОСО 42-28-85П

Стандарт мутности по McFarland (№ 1 - 7)

 

Реактивы и питательные среды

Агар микробиологический

ГОСТ 17206-84

Вода дистиллированная

ГОСТ 6709-72

D-глюкоза, ч

ГОСТ 6038-79

D-лактоза, 1-водная

ТУ 6-09-22-98-79

Натрий фосфорно-кислый однозамещенный, ч

ГОСТ 4198-75

Натрий фосфорно-кислый двухзамещенный, хч

ГОСТ 2493-75

Натрий хлористый, хч

ГОСТ 4328-77

Масло иммерсионное для микроскопии

ГОСТ 31739-78

Набор реактивов для окраски по Граму

 

Спирт этиловый ректификованный технический

ГОСТ 18300-87

Питательные среды

Питательные среды

ГОСТ 10444.1 и ГОСТ 10444.11

Для определения количества мезофильных аэробных и факультативно-анаэробных микроорганизмов

ТУ 9229-083-00419785-97

Питательный бульон

ТУ 10-02-02-789-176-94

Питательные среды для определения энтеробактерий

ТУ 9229-072-00419785-97

ГОСТ 29184-91

Среды для определения дрожжей и микроскопических грибов (агар Сабуро, сывороточный и др.)

ТУ 9229-083-00419785-97

Среды для определения S. aureus (типа Байд-Паркера, солевой агар)

ГОСТ 10444.1, п. 5.1, п. 5.4

Среды для выращивания бифидобактерий, молочно-кислых и пропионово-кислых бактерий (ГМС, М17, MRS)

ТУ 10-02-02-789-192-95

Молоко обезжиренное

ГОСТ 10444.1

Мясо-пептонный агар

ГОСТ 10444.1

Штаммы

Штаммы контрольные (референтные) одного и того же вида с испытуемым, тест-культуры энтеропатогенных штаммов.

Тест-культуры энтеропатогенных штаммов, используемые в настоящем разделе, должны иметь паспортные данные и принадлежать к Американской типовой коллекции культур (АТСС) или получены из музея культур Государственного НИИ стандартизации и контроля медицинских биологических препаратов им. Л.А. Тарасевича.

Приготовление растворов, реактивов, красок, индикаторов и питательных сред по ГОСТ 10444.1.

Культивирование микроорганизмов - по ГОСТ 26670-91.

Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29000. Питательные среды и препараты отечественного производства должны соответствовать нормативной документации, утвержденной в установленном порядке. При их применении необходимо руководствоваться рекомендациями изготовителя.

Сущность метода

Антагонистические свойства изолятов молочнокислых бактерий устанавливают методом отсроченного антагонизма и методом лунок.

В качестве индикаторных культур (тест-культур) используют вирулентные штаммы эшерихий, сальмонелл, стафилококков и др. микроорганизмов, с паспортами, характеризующими их свойства.

1. Метод лунок включает следующие этапы:

- подготовку исследуемого антагонистического штамма;

- подготовку тест-культур микроорганизмов;

- приготовление взвести испытуемого антагонистического штамма;

- приготовление взвеси тест-культур (эшерихий, сальмонелл, стафилококков или любой другой культуры);

- внесение взвеси тест-культур в расплавленный агар;

- внесение в лунки в агаре с тест-культурами взвеси антагонистического штамма;

- инкубацию в термостате;

- учет результатов.

Подготовка исследуемых штаммов

Отбирают колонию исследуемого штамма 3 - 5 генерации двухсуточного роста и переносят в бульон МРС. Выращивают при (39,1 ± 0,1) °С в течение 46 - 48 ч. Посевы просматривают на активность роста. Затем двухсуточные расплодки каждого штамма пересевают в полужидкий агар МРС (0,75 % агар) из расчета одна петля культуры на 4,5 мл агара и выдерживают в анаэробном термостате при (39,1 ± 0,1) °С в течение 26 - 28 ч.

Подготовка тест-культур микроорганизмов

Отбирают колонии S-формы тест-культуры суточного роста на МПА и готовят взвеси на физиологическом растворе, которые доводят по оптическому стандарту мутности до значения 10 ед стандарта. Вносят подготовленные взвеси в расплавленный и остуженный агар МПА из расчета 2,5 - 3 мл взвеси на 100 мл агара, разливают по пластиковым чашкам Петри с диаметром дна 9 см (30 - 35 см3 агара в каждую чашку), установленным на строго горизонтальной поверхности, после чего ставят для застывания в бытовой холодильник, затем стерильным пробойником Ø 7 мм делают лунки. В каждую лунку вносят мерно по 0,2 мл взвеси испытуемого штамма лактобацилл или бифидобактерий.

Чашки помещают в аэробный термостат при температуре (39,05 ± 0,5) °С на 22 - 24 ч, после чего замеряют зоны задержки роста тест-культур (мм) вокруг лунок с посевами.

Учет результатов

Учитывают наличие зон задержки роста и диаметры зон с точностью до 1 мм с учетом диаметра самой лунки. К слабым антагонистам относят лактобациллы и бифидобактерии, метаболиты которых образовывают зоны задержки роста тест-культур от 10 до 15 мм, к средним - от 15 до 20 мм, к сильным - более 20 мм.

2. Метод отсроченного антагонизма включает следующие этапы:

- подготовку исследуемого антагонистического штамма;

- подготовку тест-культур микроорганизмов;

- приготовление взвести испытуемого антагонистического штамма;

- приготовление взвеси тест-культур (эшерихий, сальмонелл, стафилококковое или любой другой культуры);

- штриховой посев взвеси штамма антагониста на агар;

- инкубация в термостате;

- штриховой подсев взвеси тест-культур;

- инкубация в термостате;

- учет результатов.

Отбирают колонию исследуемого штамма лактобацилл 3 - 5 генерации двухсуточного роста и переносят в бульон МРС. Термостатируют при (36 ± 1) °С в течение 48 ч. Расплавленный агар Хоттингера разливают по пластиковым чашкам Петри с диаметром дна 9 см (30 - 35 см3 агара в каждую чашку) и подсушивают в термостате. Культуры штамма лактобацилл, выросшие на жидкой питательной среде, штрихом высевают на поверхность плотной питательной среды. Термостатируют в течение 48 ч, затем 48 ч выдерживают при комнатной температуре (20 - 22 °С).

Подготовка тест-культур микроорганизмов

Отбирают колонии S-формы тест-культуры суточного роста на МПА и готовят взвеси на физиологическом растворе, которые доводят по оптическому стандарту мутности до значения 10 ед стандарта.

После этого на поверхность среды перпендикулярно к штриху антагонистического штамма высевают штрихами индикаторные культуры тест-штаммов. Посевы инкубируют при (36 ± 1) °С в течение 24 ч и измеряют длину задержки роста тест-культур по штриху в мм.

Учет результатов

При исследовании антагонизма методом штриховых подсевов к слабым в антагонистическом отношении лактобациллам и бифидобактериям относят культуры, образующие зоны задержки роста индикаторного штамма от 4 до 9 мм, к средним в антагонистическом отношении микроорганизмам относят культуры, образующие зону от 9 до 14 мм, от 14 мм и более - к высокоактивным антагонистам.

6.4.1.3. Определение антагонистической активности бифидобактерий
в отношении патогенных и условно-патогенных микроорганизмов
методом развивающихся смешанных популяций

Метод пригоден для определения антагонизма консорциума бифидобактерий.

Антагонистическую активность бифидобактерий определяют методом развивающихся смешанных популяций в сравнении с ростом тест-штаммов в монокультурах. Для этого 18 - 24 ч культуру бифидобактерий, выращенную на среде ГМК-2, нейтрализуют 5 %-м раствором аммиака до pH 7,0 ± 0,2. Количество клеток 18 - 20 ч культуры тест-штаммов 2 - 3 генерации смывают со скошенного агара физиологическим раствором и разводят до густоты 5 ед. по стандарту мутности ГИСК им. Тарасевича (что соответствует 0,5 млрд клеток в 1 мл). Тест культурами служат: Е. coli 0147, S. aureus 209р, Sh. flexneri 337, Sh. sonnei 174, Proteus vulgaris F-30, полученные из официальных депозитариев микробных культур.

В пробирки с 18 мл питательной среды ГМК-2 вносят 2 мл суспензии каждого тест штамма (в одну пробирку засевают один штамм). Для контроля роста этих штаммов пробирки с монокультурами инкубируют при 37 °С в течение 72 ч.

В опытные пробирки, засеянные тест-штаммами тем же способом, вносят культуру консорциума бифидобактерий в объеме 1 мл на 18 мл питательной среды. Подготовленные таким образом смешанные посевы инкубируют при 37 °С в течение 72 ч.

Через 24, 48 и 72 ч в контрольных и опытных пробирках определяют количество тест-штаммов высевом их на МПА и рассчитывают коэффициент их выживаемости.

6.4.1.4. Тестирование кислотоустойчивости штаммов
(к действию желудочного сока)

Исследуемый штамм засевают на целлофан, наложенный на агаризованную среду МРС, с последующим инкубированием при температуре 37 °С в течение 16 - 18 ч (для бифидобактерий - в условиях анаэробиоза). Выросшую культуру смывают забуференным физиологическим раствором и доводят концентрацию до 109 КОЕ/мл. В пробирку с 1 мл бактериальной взвеси добавляют 9 мл медицинского препарата желудочного сока, в контроль - 9 мл буферного раствора. Пробирки выдерживают в термостате при 37 °С в течение двух часов, затем определяют количество жизнеспособных клеток методом серийных разведений с последующим высевом на среду МРС или тиогликолевую.

6.4.1.5. Тестирование устойчивости штаммов к желчи
и способности к деструкции холестерина, триглицеридов

Аппаратура, материалы, лабораторная посуда,
реактивы и питательные среды *

________

* Допускается использовать другие аппаратуру, оборудование, материалы, реактивы, диагностические тест-системы и питательные среды с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Лабораторная посуда и материалы

Пробирки стеклянные узкие и широкие

ГОСТ 25336-82Е

Флаконы стеклянные на 250 и 500 мл

ГОСТ 10782-77

Пипетки стеклянные градуированные на 1, 2, 5, 10 мл

 

Чашки Петри стеклянные и пластиковые

ГОСТ 25336-82Е

Спиртовки стеклянные лабораторные

ГОСТ 25336-82Е

Штативы пластмассовые на 6 - 40 гнезд

 

Корнцанги и пинцеты для обжига пламенем

 

Спирт 96 % ректификат

ГОСТ 5962-67

Набор красителей для окраски препаратов по Граму

 

Масло иммерсионное (кедровое)

ГОСТ 137389-78

Наконечники 1 - 5 мл

 

Бумага фильтровальная

ГОСТ 12026-76

Вата медицинская

ГОСТ 5556-81

Марля медицинская

ГОСТ 9412-87

Растворы и питательные среды

Вода дистиллированная

 

Раствор физиологический

 

Агар мясо-пептонный

 

Среда Сабуро плотная

 

Питательные среды для накопления биомассы лактобацилл и бифидобактерий

 

Среда Блаурокка

 

Желчь медицинская консервированная

 

Субстраты холестерина, триглицеридов (донорская плазма, яичный желток)

 

Аппаратура

Термостат суховоздушный с диапазоном измерений рабочих температур от комнатной до 60 °С

 

Автоматический биохимический анализатор

 

Центрифуга с угловым ротором на 8 стаканов по 70 мл

 

Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29000.

Питательные среды и препараты отечественного производства должны соответствовать нормативной документации, утвержденной в установленном порядке. При их применении необходимо руководствоваться рекомендациями изготовителя.

Подготовка исследуемых штаммов микроорганизмов

Получение культуры 1-й генерации

Для получения маточной культуры ампулу или флакон каждого из лиофилизированных штаммов вскрывают стерильно и стерильной пипеткой вносят 3 - 5 мл 0,9 % NaCl. По 0,5 - 1 мл полученной взвеси той же пипеткой вносят в 2 пробирки с 9 мл среды Блаурокка. Таким образом, соотношение культур посевного материала к объему среды составляло 1:10 или 1:20. Инкубируют в термостате при температуре (37 ± 1) °С в течение 20 ч.

Контроль. Для контроля посеянной культуры содержимое каждого флакона высевают по 0,5 мл в пробирки со скошенным мясо-пептонным агаром (МПА) и средой Сабуро. Посевы на МПА инкубируют при температуре (37 ± 1) °С в течение 1 суток, на среде Сабуро - при температуре (22 ± 2) °С в течение 8 суток. Предварительный учет результатов проводят через 48 - 72 ч. Проводят также микроскопию мазков, окрашенных по Граму. В мазках должны присутствовать только грамположительные лактобактерии и бифидобактерии характерной морфологии. Указанным контролем сопровождают все дальнейшие пересевы культуры.

Через сутки инкубации в пробирках наблюдается интенсивный рост с характерным помутнением и частичным обесцвечиванием в верхней части до светло-желтого цвета. При окраске по Граму и микроскопии наблюдают средние грамположительные палочки, без спор, расположенные небольшими цепочками (лактобациллы) и зернистые прямые или изогнутые с утолщением или ветвлением на одном или двух концах, булавовидной или лопатовидной формы, располагающиеся в виде скоплений или отдельных клеток (бифидобактерии).

Получение культуры 2-й генерации

Из пробирок с выросшими в среде Блаурокка культурами делают пересевы в широкие пробирки со средами для бифидо- и лактобактерий из расчета 6 - 8 % к объему среды. Из засеянных пробирок переносят 1 мл культуры в ряд из 10 пробирок со средой Блаурокка, для определения количества живых микробных клеток культуры 1-й генерации методом серийных разведений. Ряд последовательных десятикратных разведений готовят до 10-9. Культуры 2-й генерации инкубируют при температуре (37 ± 1) °С в течение суток. Пробирки с десятикратными разведениями инкубируют при (37 ± 1) °С в течение 30 - 40 ч. Затем проводят подсчет выросших характерных колоний в пробирках с последними разведениями. Через сутки в пробирках наблюдается интенсивный рост с характерным помутнением и частичным обесцвечиванием в верхней части до светло-желтого цвета.

Получение культуры 3-й генерации

После контроля на отсутствие посторонней микрофлоры в выращенных культурах 2-й генерации, делают засев культур из расчета 6 - 8 % от объема среды.

Культуру смеси лактобацилл инкубируют в термостате при температуре (37 ± 1) °С в течение 20 - 24 ч. Посевы штаммов сопровождают всеми перечисленными контролями, число микробных клеток в среде устанавливают по оптическому стандарту мутности.

Определение устойчивости бактерий к действию желчи

Для определения используют свежую культуру 3-й генерации с концентрацией клеток 108 - 109 КОЕ/мл. В пробирку с 1 мл бактериальной взвеси добавляют 9 мл желчи медицинской консервированной; контроль - 9 мл физраствора. Все пробирки выдерживают в термостате при 37 °С в течение двух часов, затем определяют количество жизнеспособных клеток методом серийных разведений.

Метод серийных разведений

Для определения количества жизнеспособных клеток разливают по 9 мл среды Блаурокка для титрования в 10 пробирок вместимостью 15 мл. В первую пробирку добавляют 1 мл культуры и после перемешивания пипеткой не менее 10 раз, проводят серию 10-кратных разведений. Пипетки меняют после каждого разведения. Пробирки инкубируют при (37 ± 1) °С в течение 30 - 72 ч в аэробных или анаэробных условиях в зависимости от вида микроорганизма, затем проводят подсчет выросших характерных колоний в пробирках с последними разведениями. Определяют количество живых бактерий в 1 мл по формуле:

X = a10n, где

X - количество живых особей в 1 мл;

а - количество колоний в последней пробирке, в которой отмечается рост;

n - степень разведения.

При отсутствии дифференцированных колоний рост или отсутствие роста культуры отмечают визуально (после встряхивания пробирки) по наличию или отсутствию мутности, а также контролируют выборочно по микроскопическому препарату.

По количеству жизнеспособных клеток делают выводы об устойчивости бактерий к желчи.

Определение способности культур к деградации холестерина

Способность бактерий к деградации холестерина определяют в питательной среде, оптимальной для испытуемого микроорганизма. Субстрат, содержащий холестерин, добавляют к среде до конечной концентрации холестерина 1,5 ммоль/л, но не более 30 %. Культуры бактерий 3-й генерации, содержащих 109 КОЕ/мл, вносят в питательную среду с холестерином в количестве 10% от общего объема. Инкубирование проводят в микроаэрофильных условиях при 37 °С в течение 24 ч. После этого микробные клетки осаждают центрифугированием при 4000 об./мин 30 мин и определяют содержание холестерина в супернатанте общепринятыми биохимическими методами или на биохимическом анализаторе.

Определение способности пробиотических культур к деградации триглицеридов

Способность бактерий к деградации триглицеридов определяют в питательной среде, оптимальной для испытуемого микроорганизма. Субстрат, содержащий триглицериды, добавляют к среде до конечной концентрации холестерина 8,5 ммоль/л. Культуры бактерий 3-й генерации, содержащих 109 КОЕ/мл, вносят в питательную среду с триглицеридами в количестве 8 - 10 % от общего объема. Инкубирование проводят в микроаэрофильных условиях при 37 °С в течение 24 ч. После этого микробные клетки осаждают центрифугированием при 4000 об./мин 30 мин и определяют содержание триглицеридов в супернатанте общепринятыми биохимическими методами или на биохимическом анализаторе.

6.5. Дополнительные методы исследования пробиотического
потенциала штаммов

6.5.1. Тестирование in vitro

6.5.1.1. Изучение антиадгезивных свойств штаммов на клеточных моделях

Изучение антиадгезивных свойств лактобацилл и бифидобактерий проводят двумя методами. В первом методе используют прямую реакцию антиадгезивной активности культур, во втором - косвенную, используя супернатанты культур лактобацилл и бифидобактерий.

6.5.1.1.1. Прямая антиадгезивная активность.

Прямую антиадгезивную активность лактобацилл и бифидобактерий изучают на эритроцитах крови человека, используя культуры лактобацилл, бифидобактерий и культуры тест-штаммов.

Метод включает следующие этапы:

- приготовление взвести микроорганизма;

- приготовление взвеси тест-культур (эшерихий, сальмонелл, стафилококковое или любой другой интересующей исследователя культуры);

- приготовление взвеси эритроцитов;

- внесение в пробирки или в лунки планшет взвеси эритроцитов;

- внесение в пробирки или в лунки планшет суспензии культур микроорганизмов и тест-штамма;

- аккуратное перемешивание смеси эритроцитов и суспензии культур;

- инкубация в термостате;

- приготовление мазков;

- учет результатов.

Приготовление взвеси микроорганизма

Колонии штамма лактобацилл, выращенные на плотной питательной среде, снимают бактериологической петлей и на стерильном забуференном фосфатами изотоническом растворе хлорида натрия готовят суспензию клеток в концентрации 1109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Культуры бифидобактерий, выращенные на полужидкой или жидкой питательной среде, осаждают центрифугированием при 1500 - 2000 об./мин в течение 25 - 30 мин и дважды отмывают от среды культивирования стерильным забуференным раствором. Полученные взвеси доводят забуференным раствором до концентрации 1×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Приготовление взвеси тест-культур

Колонии тест-штаммов патогенных и условно-патогенных микроорганизмов, выращенные на плотной питательной среде, снимают бактериологической петлей и на стерильном забуференном фосфатами изотоническом растворе хлорида натрия готовят суспензию клеток в концентрации 1×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Приготовление взвеси эритроцитов

Эритроциты человека 0 (I) группы Rн+ дважды отмывают центрифугированием при 1000 об./мин в течение 30 мин от консервирующего раствора в забуференном фосфатами изотоническом растворе хлористого натрия и готовят 1 %-ю взвесь в стерильном физиологическом растворе. С этой целью к 1 см3 эритроцитов, помещенных в 200 см3 колбу, добавляют 99 см3 стерильного физиологического раствора. Взвесь аккуратно перемешивают до образования однородной суспензии.

Постановка реакции

Приготовленную взвесь эритроцитов вносят по 1 см3 в пробирки или по 0,2 см3 в лунки планшет с U-дном. Далее в тех же количествах вносят суспензии культур лактобацилл или бифидобактерий и тест-штамма.

В параллельный ряд пробирок или лунок вносят по 0,1 см3 взвеси эритроцитов и равный объем взвеси тест-штаммов.

Взвеси аккуратно перемешивают и выдерживают в термостате при (39,1 ± 0,1) °С в течение 30 мин при постоянном встряхивании на шуттель-аппарате.

Для открепления слабо связанных бактерий используют стандартную процедуру двукратного отмывания центрифугированием при 1000 об./мин в течение 10 мин в забуференном фосфатами растворе хлорида натрия.

Из осадка готовят мазки, высушивают на воздухе, фиксируют этиловым спиртом и окрашивают по Граму, допускается проводить окраску по Романовскому-Гимза.

Учет результатов

В препаратах подсчитывают число тест-культур, прикрепившихся к 50 эритроцитам в одном поле зрения. Параллельно подсчитывают количество микроорганизмов, прикрепившихся к эритроцитам в параллельной пробе, в которую не добавляли культуры лактобацилл и бифидобактерий.

Сравнивают полученные данные и проводят учет результатов в процентах. Если количество клеток тест-штамма, прикрепившихся к 50 эритроцитам в смешанной с культурами лактобацилл или бифидобактерий, меньше, чем в чистой пробе, считается, что культуры лактобацилл или бифидобактерий обладают антиадгезивными свойствами.

6.5.1.1.2. Непрямой метод изучения антиадгезивных свойств

Метод включает следующие этапы:

- приготовление супернатантов микроорганизма;

- приготовление взвеси тест-культур;

- приготовление взвеси эритроцитов;

- внесение в пробирки супернатантов и суспензии культуры тест-штамма;

- внесение в пробирки или в лунки планшет взвеси эритроцитов и суспензии культуры штамма;

- аккуратное перемешивание смеси эритроцитов и суспензии культуры тест-штамма;

- инкубация в термостате;

- приготовление мазков;

- учет результатов.

Приготовление супернатантов микроорганизма

Двухсуточные культуры лактобацилл и бифидобактерий на жидкой среде осаждают центрифугированием при 5000 об./мин в течение 20 мин.

Приготовление взвеси тест-культур

Колонии тест-штаммов патогенных и условно-патогенных микроорганизмов, выращенные на плотной питательной среде, снимают бактериологической петлей и на стерильном забуференном фосфатами изотоническом растворе хлорида натрия готовят суспензию клеток в концентрации 1×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Приготовление взвеси эритроцитов

Эритроциты человека 0 (I) группы Rн+ дважды отмывают центрифугированием при 1000 об./мин в течение 30 мин от консервирующего раствора в забуференном фосфатами изотоническом растворе хлористого натрия и готовят 1 %-ю взвесь в стерильном физиологическом растворе. С этой целью к 1 см3 эритроцитов, помещенных в 200 см3 колбу, добавляют 99 см3 стерильного физиологического раствора. Взвесь аккуратно перемешивают до образования однородной суспензии.

Внесение в пробирки супернатантов и суспензии культуры тест-штамма

Полученные супернатанты лактобацилл или бифидобактерий разливают по 5,0 см3 в два параллельных ряда пластиковых пробирок, после чего в них добавляют по 1,0 см3 взвеси культур тест-штаммов.

Контролем служит взвесь культур тест-штаммов, подготовленных аналогично и внесенных в пробирки со стерильным забуференным фосфатами изотоническим раствором хлорида натрия.

Посевы выдерживают в термостате при (39,1 ± 0,1) °С в течение 60 и 90 мин при постоянном встряхивании на шуттель-аппарате.

Культуры осаждают центрифугированием при 1500 - 2000 об./мин в течение 25 - 30 мин. Полученные взвеси доводят забуференным физиологическим раствором до концентрации 1×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Внесение в пробирки или в лунки планшет взвеси эритроцитов и суспензии культуры штамма

Приготовленную взвесь эритроцитов вносят по 1 см3 в пробирки или по 0,1 см3 в лунки планшет с U-дном. Далее в тех же количествах вносят суспензии культуры тест-штамма.

В параллельный ряд пробирок или лунок вносят по 0,1 см3 взвеси эритроцитов и равный объем контрольной взвеси тест-штамма.

Взвеси аккуратно перемешивают и выдерживают в термостате при (39,1 ± 0,1) °С в течение 30 мин при постоянном встряхивании на шуттель-аппарате.

Из препаратов готовят мазки, окрашивают их по Граму или по Романовскому-Гимза и подсчитывают количество грамотрицательных микроорганизмов, прикрепившихся к 50 попавшим в поле зрения эритроцитам.

Сравнивают полученные данные и проводят учет результатов в процентах. Если количество клеток тест-штамма, прикрепившихся к 50 эритроцитам в системе метаболит + тест-штамм, меньше, чем в контрольной пробе, считается, что культуры лактобацилл или бифидобактерий вырабатывают метаболиты, подавляющие адгезию.

6.5.1.2. Исследование адгезивности на клеточных моделях

Аппаратура, материалы, лабораторная посуда,
реактивы и питательные среды *

________

* Допускается использовать другие аппаратуру, материалы, питательные среды и реактивы с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Аппаратура и инструментарий

Анализатор потенциометрический, погрешность измерений pH ±0,01

ГОСТ 19881-74

Баня водяная с подогревом

ГОСТ 12026-76

Весы лабораторные общего назначения 2 и 4 класса точности, с наибольшим пределом взвешивания 200 г

ГОСТ 24104-88

Горелка спиртовая

ГОСТ 25336

Дистиллятор, обеспечивающий качество дистиллированной воды

ГОСТ 6709-72

Микроволновая печь для быстрого плавления плотных питательных сред

 

Микроскоп биологический МБИ-2, МБИ-3, МБР-3

ГОСТ 8284-78

Облучатель бактерицидный настенный ОБН-150 или других видов

ТУ 16-535-84

Смеситель лабораторный или ступка фарфоровая

ГОСТ 9147

Стерилизаторы паровые медицинские или аналогичные

 

Термостат, позволяющий поддерживать рабочую температуру (28 - 37) °С отклонением от заданной ±1 °С

ГОСТ 19569-89Е

Холодильник бытовой электрический

 

Шкаф сушильный стерилизационный ШСС-80П или других марок, позволяющий поддерживать температуру (160 ± 5) °С

 

Центрифуга лабораторная Шуттель-аппарат

 

Лабораторная посуда и материалы

Бумага фильтровальная лабораторная

ГОСТ 12026-76

Вата медицинская гигроскопическая

ГОСТ 5556-81

Колбы плоскодонные конические или круглые разной вместимости

ГОСТ 1770-74

Марля медицинская

ГОСТ 9412-77

Микробиологические петли

 

Ножницы, скальпель, пинцет

ГОСТ 21241

Пипетки вместимостью от 1 до 10 см3

ГОСТ 29227-91

Полистироловые планшеты U-образные

 

Посуда лабораторная стеклянная

 

Пипетки градуированные

ГОСТ 29227-91

Приборы мерные лабораторные стеклянные

 

Бюретки, пипетки

ГОСТ 29162-92

Стекла предметные

ГОСТ 9284

Термометр ртутный с диапазоном измерения от 0 до 100 °С (цена деления шкалы 1 °С)

 

Чашки биологические (Петри)

ГОСТ 23932-90

Стандартный образец мутности на 10 ед.

ОСО 42-28-85П

Стандарт мутности по McFarland

 

Реактивы и питательные среды

Агар микробиологический

ГОСТ 17206-84

Вода дистиллированная

ГОСТ 6709-72

Натрий фосфорно-кислый однозамещенный, ч

ГОСТ 4198-75

Натрий фосфорно-кислый двухзамещенный, хч

ГОСТ 2493-75

Натрий хлористый, хч

ГОСТ 4328-77

Масло иммерсионное для микроскопии

ГОСТ 31739-78

Набор реактивов для окраски по Граму

 

Набор реактивов для окраски по Романовскому-Гимза

 

Спирт этиловый ректификованный технический

ГОСТ 18300-87

Питательные среды

Питательный бульон

ТУ 10-02-02-789-176-94

Питательные среды для определения энтеробактерий

ТУ 9229-072-00419785-97

Среды для выращивания бифидобактерий, молочно-кислых и пропионово-кислых бактерий (ГМС, M17, MRS)

ТУ 10-02-02-789-192

Мясо-пептонный агар, приготовленный

ГОСТ 10444.1

Материалы и штаммы

- формалинизированные эритроциты человека 0 (I) группы Rн+

- 20-дневные куриные эмбрионы

- исследуемые штаммы лактобацилл или бифидобактерий

- тест-штаммы - в качестве индикаторных используют штаммы видов микроорганизмов, по отношению к которым изучается антиадгезивная активность.

Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29000. Питательные среды и препараты отечественного производства должны соответствовать нормативной документации, утвержденной в установленном порядке. При их применении необходимо руководствоваться рекомендациями изготовителя.

Сущность метода

Адгезивные свойства лактобацилл определяют на формалинизированных эритроцитах человека 0 (1) группы Rн+ и на энтероцитах тонкого отдела кишечника эмбрионов поросят или 20-дневных эмбрионов цыплят птицы.

Выполнение метода включает следующие этапы:

- приготовление суспензии микроорганизма;

- приготовление взвеси эритроцитов;

- внесение в пробирки или в лунки планшет взвеси эритроцитов;

- внесение в пробирки или в лунки планшет суспензии культуры штамма;

- аккуратное перемешивание смеси эритроцитов и суспензии культур;

- инкубация в термостате;

- приготовление мазков;

- учет результатов.

Приготовление суспензии микроорганизма

Колонии штамма лактобацилл, выращенные на плотной питательной среде, снимают бактериологической петлей и на стерильном забуференном фосфатами изотоническом растворе хлорида натрия готовят суспензию клеток в концентрации 1×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Культуры бифидобактерий, выращенные на полужидкой или жидкой питательной среде, осаждают центрифугированием при 1500 - 2000 об./мин в течение 25 - 30 мин и дважды отмывают от среды культивирования стерильным забуференным раствором. Полученные взвеси доводят забуференным раствором до концентрации ×109 КОЕ/см3, используя стандарты мутности, выпускаемые ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Приготовление взвеси эритроцитов.

Эритроциты человека 0 (I) группы Rн+ дважды отмывают центрифугированием при 1000 об./мин в течение 30 мин от консервирующего раствора в забуференном фосфатами изотоническом растворе хлористого натрия и готовят 1 %-ю взвесь в стерильном физиологическом растворе. С этой целью к 1 см3 эритроцитов, помещенных в 200 см3 колбу, добавляют 99 см3 стерильного физиологического раствора. Взвесь аккуратно перемешивают до образования однородной суспензии.

Приготовленную взвесь эритроцитов вносят по 1 см3 в пробирки или по 0,1 см3 в лунки планшет с U-дном. Далее в тех же количествах вносят суспензии штаммов, и взвеси аккуратно перемешивают и выдерживают в термостате при (39,1 ± 0,1)°С в течение 30 мин при постоянном встряхивании на шуттель-аппарате.

Для открепления слабо связанных бактерий используют стандартную процедуру двукратного отмывания центрифугированием при 1000 об./мин в течение 10 мин в забуференном фосфатами растворе хлорида натрия.

Из осадка готовят мазки, высушивают на воздухе, фиксируют этиловым спиртом и окрашивают по Романовскому-Гимза.

В препаратах подсчитывают число микроорганизмов, прикрепившихся к 50 эритроцитам в одном поле зрения. Учет реакции проводят по среднему показателю адгезии (СПА). При СПА от 0 до 1,0 микроорганизм считали неадгезивным, от 1,01 до 2,00 - низкоадгезивным, от 2,01 до 4,00 - среднеадгезивным и от 4,01 и в более -высокоадгезивным.

6.5.1.2.1. Определение адгезивности штамма и референтного штамма в отсутствии D-маннозы

Адгезивные свойства штамма и контрольного штамма первоначально определяются методом гемагглютинации эритроцитов человека или животных (мыши, крысы, кролика, барана и др.) в отсутствии D-маннозы (маннозо-чувствительная адгезия). При этом метод может выполняться в макро- (пробирках) и микровариантах (планшетах).

Выполнение метода включает следующие этапы:

- приготовление взвеси эритроцитов;

- приготовление суспензии микроорганизма;

- внесение в пробирки или в лунки планшет взвеси эритроцитов;

- внесение в пробирки или в лунки планшет суспензии культуры штамма;

- аккуратное перемешивание смеси эритроцитов и суспензии культур;

- инкубация в термостате при 37 °С в течение 1 ч;

- предварительный учет результатов;

- инкубация смеси эритроцитов и суспензии микроорганизма при комнатной температуре в течение 18 ч;

- окончательный учет результатов.

Постановка реакции гемагглютинации с эритроцитами человека или животных включает следующие этапы.

Приготовление взвеси эритроцитов

Из тщательно отмытых эритроцитов готовят 1 %-ю взвесь в стерильном физиологическом растворе. С этой целью к 1 см3 эритроцитов, помещенных в 200 см3 колбу, добавляют 99 см3 стерильного физиологического раствора. Взвесь аккуратно перемешивают до образования однородной суспензии.

Приготовление суспензии культуры штамма

Культуру штамма, выращенную на плотной питательной среде, смывают стерильным физиологическим раствором и готовят суспензию клеток в концентрации 1×109 КОЕ/см3, используя стандарты мутности ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7). Приготовленную 1 %-ю взвесь эритроцитов вносят по 1 см3 в пробирки или по 0,1 см3 в лунки планшет с U-дном. Далее в тех же количествах вносят суспензию штамма, и взвесь аккуратно перемешивают. Пробирки закрывают пробками, планшет - крышкой и помещают в термостат при температуре, оптимальной для исследуемого вида культуры, на 1 ч.

После инкубации пробирок или планшета в термостате их вынимают и проводят предварительный учет результатов. При наличии адгезивных свойств у штамма эритроциты распределяются равномерно по всей поверхности дна. При отрицательном результате все эритроциты собираются в виде точки в середине дна пробирки или лунки планшета. Окончательные результаты исследования учитывают через 18 ч после инкубации пробирок или планшета при комнатной температуре.

6.5.1.2.2. Определение адгезивности штамма и референтного штамма в присутствии D-маннозы

При выявлении выраженной гемагглютинационной активности штамма ту же реакцию проводят с использованием D-маннозы для определения маннозо-чувствительной или маннозо-резистентной адгезии.

Постановка метода в данном варианте проводится аналогично предыдущему пункту, к которому добавляется ряд пробирок или лунок, в которые внесена 1 % D-манноза.

В случае маннозо-чувствительной гемагглютинации (адгезии) наблюдается оседание эритроцитов в виде точки в середине дна пробирки или лунки. Маннозо-устойчивая гемагглютинация наблюдается и при добавлении D-маннозы в реакционную взвесь. При выявлении гемолитической и адгезивной активности у штамма в экспериментах in vitro необходимы исследования на экспериментальных моделях in vivo.

6.5.1.2.3. Адгезивный процесс на энтероцитах куриных эмбрионов изучают по описанной методике.

Подготовка энтероцитов кишечника куриных эмбрионов

Эмбрионы цыплят 20-дневного возраста осторожно извлекают из скорлупы, предварительно обработанной этиловым спиртом. Эмбрионы умерщвляют и извлекают кишечник по всей длине. Кишечник вскрывают и стерильным скальпелем соскабливают всю его поверхность. Полученные соскобы переносят в стерильный, забуференный фосфатами изотонический раствор хлорида натрия и пропускают через капроновый фильтр для освобождения от кусочков ткани. Полученные взвеси осаждают центрифугированием при 1500 - 2000 об./мин в течение 25 - 30 мин и готовят взвесь с концентрацией по оптическому стандарту мутности, равную 10 ед, используя стандарты мутности ГИСК им. Тарасевича, или стандарт McFarland (№ 1 - 7).

Постановку реакции адгезии осуществляют вышеописанным способом.

6.5.2. Тестирование in vivo

6.5.2.1. Определение адгезивности

Адгезивные свойства могут быть исследованы на ряде биологических моделей (развивающиеся куриные эмбрионы, энтерально зараженные мыши-сосунки, перевязанная петля тонкого кишечника кроликов) и методом гемагглютинации эритроцитов человека или животных.

Наиболее простым и универсальным методом определения адгезивных свойств бактерий является выявление способности микроорганизмов вызывать гемагглютинацию эритроцитов человека и животных.

В связи с этим адгезивность штамма первоначально определяется методом гемагглютинации. При выявлении способности штамма агглютинировать эритроциты человека и животных далее, в зависимости от вида культуры, будет использоваться одна из биологических моделей на животных.

Определение адгезивности штамма in vivo

При подтверждении гемагглютинационной активности штамма с использованием D-маннозы возможно количественное определение адгезии in vivo при использовании биологических моделей (развивающиеся куриные эмбрионы, энтерально зараженные мыши-сосунки, перевязанная петля тонкого кишечника кроликов). Ниже приведено описание модели для исследования адгезивной активности штаммов микроорганизмов на модели перевязанной петли тонкого кишечника 12 - 14-дневных крольчат.

Материалы, аппаратура и инструментарий *

________

* Допускается использовать другие аппаратуру, материалы и инструментарий с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Термостат, позволяющий поддерживать рабочую температуру 28 - 37 °С с отклонением от заданной ±1 °С

ТУ 64-1-1382-72

Микроскоп биологический МБИ-2, МБИ-3, МБР-3

ГОСТ 8284-78

Облучатель бактерицидный настенный ОБН-150 или других видов

ТУ 16-535-84

Пинцет медицинский

ГОСТ 21241-89

Ножницы медицинские

ГОСТ 21239-89

Скальпель медицинский хирургический, 15 см

ГОСТ 21240-89

Шприцы медицинские 1 или 0,1 см3

 

Штативы для пробирок

 

Животные и штаммы

12 - 14-дневные крольчата

Культура штамма или контрольного (референтного) штамма того же вида

Сущность метода

В каждый опыт берут не менее 3 крольчат. Животных фиксируют на специальном столе и внутримышечно во внутреннюю область бедра вводят тиопентал натрия (0,1 мл 1 %-го раствора на 50 г веса животного). Наркотический эффект наступает через 2 - 3 мин. По средней линии живота крольчонка делают разрез брюшины по 1 см в обе стороны от пупка. Извлекают петли дистального отдела тонкого кишечника и в его просвет на расстоянии 3 - 5 см от уровня верхушки аппендикса, имеющего общую брыжейку с подвздошной кишкой, вводят с помощью иглы шприца (1,0 см3) 0,1 см3 микробной взвеси, содержащей 10 КОЕ/см3. Одновременно делают 10-кратные разведения взвеси штамма и из 3, 4 и 5-го разведений производят посевы по 0,5 см3 на плотную питательную среду, делая параллельные высевы по 2 чашки Петри на каждое разведение.

Через 1,5 ч после заражения животных усыпляют хлороформом и вскрывают. Отступя 5 - 7 см от слепой кишки, извлекают участок подвздошной кишки длиной 20 см и переносят в чашку Петри. Чтобы предупредить элиминацию штамма со слизистой кишечника исследуемый материал помещают на лед и дальнейшие процедуры проводят оперативно. Отрезки кишечника разрезают вдоль, трижды промывают в охлажденном при 4 °С растворе 0,9 %-го хлористого натрия, растирают в ступке или специальном гомогенизаторе. К растертой ткани добавляют 1 см3 0,9 %-го раствора хлористого натрия, полученные суспензии переносят в пробирки и делают 10-кратные разведения. Из 3, 4, 5-го разведений делают посевы по 0,5 см3 на плотную питательную среду, делая параллельные высевы по 2 чашки Петри на каждое разведение. Через 18 - 24 ч после инкубации при температуре, оптимальной для выращивания исследуемого вида штамма, подсчитывают число выросших колоний, изолированных со слизистой тонкого кишечника и высеянных непосредственно из пробирки до заражения кроликов. Таким образом определяется число бактерий, прикрепившихся к слизистой тонкого кишечника.

Учет и интерпретация результатов

Коэффициент адгезии для количественной оценки адгезивной активности штамма и контрольного штамма высчитывают по следующей формуле:

K - коэффициент адгезии - процент адгезивных клеток в популяции исследуемого штамма;

а - число жизнеспособных клеток, введенных в кишечник крольчат;

в - число клеток, прикрепившихся к стенке кишечника.

По степени адгезивности они оцениваются следующим образом:

а) высокоадгезивные с коэффициентом адгезии 3,0 и выше,

б) адгезивные - от 1 до 3 и в) слабоадгезивные - 0,001 - 0,9.

Слабоадгезивные штаммы, как правило, авирулентны, а адгезивные и высокоадгезивные штаммы обычно обладают определенными вирулентными свойствами.

7. Методы исследования технологических свойств
пробиотических штаммов

7.1. Определение постокислительной активности штаммов
молочнокислых бактерий

В три бутылочки заливают по 200 мл 9 %-го обезжиренного молока (90 г сухого обезжиренного молока + 1000 мл водопроводной воды, растворяют при комнатной температуре 1,5 - 2 ч с последующим нагреванием текучим паром), в каждую бутылочку вносят 2 % культуральной жидкости по объему и выдерживают до образования сгустка при температуре, оптимальной для исследуемого штамма. После термостатирования в одной бутылочке определяют pH и вязкость, а две другие бутылочки переворачивают 5 раз и охлаждают в ледяной воде 15 мин, а затем помещают в холодильник при температуре 4 °С.

Через 1 сутки и через 28 дней хранения определяют в них вязкость и pH. Перед проведением измерения бутылочку достают из холодильника, выдерживают при комнатной температуре и при 20 °С проводят измерения pH и вязкости. Другую бутылочку хранят 28 дней в холодильнике. После хранения определяют вязкость и pH.

7.2. Определение способности к образованию экзополисахаридов

Сущность метода

Определение содержания ЭПС проводится с предварительным выделением мешающих компонентов и последующим высушиванием до постоянной массы.

Аппаратура, материалы и реактивы *

________

* Допускается использовать другие аппаратуру, материалы и реактивы с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.

Центрифуга MW-340 или Т 24 Janetzki

 

Колбы мерные по ГОСТ 1770 2-го класса точности вместимостью 100 - 1000 см3 с притертыми пробками

 

Раствор фенола

ГОСТ 23519-93

Концентрированная серная кислота

ГОСТ 2184-77

Кислота трихлоруксусная кристаллическая

 

Эксикатор

ГОСТ 25336-82

Шкаф сушильный с терморегулятором, обеспечивающий постоянство температуры (105 ± 2) °С

 

Подготовка к испытанию

Питательную среду в количестве 25 см3 центрифугируют на центрифуге MW-340 или Т 24 Janetzki при 3000 об./мин в течение 30 мин. Центрифугат сливают в отдельную колбу. К осадку прибавляют небольшое количество дистиллированной воды (2 - 4 см3), тщательно перемешивают и снова центрифугируют, сливая центрифугат. Операцию промывания сгустка проводят 5 - 7 раз, пока центрифугат не даст отрицательной реакции на углеводы по фенол-серному методу, для чего к 1 см3 центрифугата прибавляют 1 см3 5 %-го водного раствора фенола и 5 см3 концентрированной химически чистой серной кислоты. В присутствии углеводов жидкость в пробирке приобретает красное окрашивание различной степени интенсивности в зависимости от количества углеводов.

Проведение испытания.

Все центрифугаты соединяют вместе, белки осаждают 50 %-м раствором трихлоруксусной кислоты, для чего к 90 см3 центрифугата добавляют 10 см3 кислоты. Выпавшие в осадок белки удаляют центрифугированием при 3000 об./мин в течение 90 мин.

К центрифугату, содержащему слизистые биополимеры, добавляют 2-кратное количество 96 %-го этанола, выдерживают при температуре (4 ± 2) °С в течение 24 ч. Выпавший осадок полимера, после отделения надосадочной жидкости с помощью центрифугирования при 3000 об./мин в течение 90 мин, сушат до постоянного веса в эксикаторе над хлористым кальцием в течение 48 ч, затем взвешивают.

Требования безопасности.

- Работы с концентрированными кислотами, щелочами и др. летучими веществами должны проводиться в вытяжном шкафу.

- Необходимо соблюдать требования техники безопасности при работе с электроприборами.

7.3. Тестирование хранимоспособности

7.3.1. Определение числа жизнеспособных бифидобактерий и
лактобацилл методом конечных разведений

Культуры пробиотических штаммов в виде закваски, бакконцентрата, биомассы в герметизированной упаковке закладываются на хранение при условиях как минимум двух температурных режимов (для сухих - минус 18 °С, 4 °С и 25 °С, для жидких - 4 °С, 9 °С) и подвергаются периодическим испытаниям на жизнеспособность, наличие посторонней микрофлоры, изучают морфологию клеток и активность кислотообразования.

Культуры засевают в соответствующие питательные среды в соответствии с общепринятыми методами анализа (НВЧ или серийных разведений) и по окончании инкубации культур, выросших на рядах пробирок с питательной средой, подсчитывали число колоний в трех конечных разведениях, в которых наблюдался рост изолированных колоний.

Общее число жизнеспособных клеток высчитывали по формуле:

X = a10n - 1, где

X - число колониеобразующих единиц бактерий в 1 мл пробы;

а - число колоний в учитываемом разведении.

7.3.2. Количественное определение ацидофильных лактобацилл

Данная методика основана на способности ацидофильных лактобацилл сквашивать молоко.

Из исследуемого образца делают 2 ряда последовательных десятикратных разведений в стерильном обезжиренном молоке не менее, чем до 10-10. Посевы выдерживают в термостате при температуре 38 °С в течение 5 суток. За это время молоко, в котором содержались ацидофильные лактобациллы, образует сгусток. Из сгустка готовят микроскопический препарат. Если в препарате видны характерные палочки, то данное разведение учитывают, как содержащее ацидофильные лактобактерии. При подсчете количества ацидофильных лактобактерий пользуются табл. 7.

Таблица 7

Коэффициенты при подсчете ацидофильных лактобацилл

Числовая характеристика

Наиболее вероятное число микробов при засеве в две параллельные пробирки

1

2

001

0,5

011

0,9

020

0,9

101

1,2

110

1,3

111

2,0

120

2,0

121

3,0

200

2,5

201

5,0

210

6,0

211

13,0

212

20,0

220

25,0

221

70,0

222

110,0

Сначала составляют числовую характеристику. Она состоит из трех цифр, указывающих количество пробирок со свернувшимся обезжиренным молоком в трех последних разведениях. Первая цифра числовой характеристики соответствует тому разведению, при котором молоко свернулось во всех пробирках. По числовой характеристике находят в таблице наиболее вероятное число микробных клеток, которое умножают на разведение, с которого начиналась первая цифра числовой характеристики. Полученное число соответствует количеству клеток ацидофильных лактобацилл в одном образце.

Пример. Молоко свернулось в двух пробирках разведения - 6, в одной пробирке разведения - 7 и в одной пробирке разведения - 8, тогда числовая характеристика результата будет 211. Она соответствует по таблице числу 13. Последнее надо умножить на число разведение 6, которому соответствует первая цифра числовой характеристики. Тогда количество живых ацидофильных лактобацилл в одном образце составляет 13×10 = 1,3×107.

7.3.3. Контроль микробной культуры на наличие
посторонней микрофлоры

Культуральную жидкость в количестве 0,1 мл высевают на агаризованные среды:

- МПА (мясопептонный агар) - для определения общего числа микроорганизмов посторонней микрофлоры;

- Сабуро - дрожжей, плесеней;

- стафилококковый агар - стафилококков, в т.ч. золотистого;

- среду Эндо - энтеробактерии.

Культуру в количестве 0,1 мл наносили на поверхность агаровой пластинки и круговыми движениями шпателя равномерно втирали. Посевы инкубировали при температуре 37 °С в течение двух суток; на среде Сабуро - при 28 °С в течение 5 суток.

При обнаружении посторонней микрофлоры данный образец браковался.

7.3.4. Изучение морфологии клеток

Данные исследования проводят с помощью микроскопии в бинокулярном микроскопе под масляной иммерсией с объективом ×100; готовят два вида препаратов для микроскопии:

- окраской по Граму с помощью стандартного набора реагентов и красителей;

- раствором метиленовой сини.

7.3.5. Определение активности кислотообразования

По две пробирки каждой культуры вынимают и ставят в холодильник для быстрого охлаждения с целью предотвращения дальнейшего продуцирования кислот. Затем по 10 мл культуральной жидкости вносят в стеклянные колбочки и по 1 капле добавляют фенолфталеин в качестве индикатора.

Общую кислотность определяют титрованием децинормальной щелочи NaOH, которую из бюретки по каплям добавляют в колбочки с налитой культуральной жидкостью до появления стойкого розового окрашивания. Количество децинормальной щелочи, которое ушло на титрование, соответствует количеству образуемой децинормальной кислоты в 10 мл культуральной жидкости.

Показатель активности кислотообразования, выраженный в градусах Тернера /°Т/, вычисляют по формуле:

°Т = а×к×10, где

а - количество миллилитров 0,1М раствора натра едкого, пошедшее на титрование;

к - поправка к титру 0,1М раствора натра едкого;

10 - поправочный коэффициент на массу анализируемой пробы.

Среднее значение активности кислотообразования рассчитывают для двух образцов.

8. Библиография

П. 5.1.3.

1. Cole JR, Chai В, Farris RJ, Wang Q, Kulam SA, McGarrell DM, Garrity GM, Tiedje JM. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis.//Nucleic Acids Res. 2005 Jan 1; 33.

2. Lilburn TG, Garrity GM. Exploring prokaryotic taxonomy.//Int J Syst Evol Microbiol. 2004 Jan ; 54 (Pt 1):7 - 13.

3. Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.//Appl Environ Microbiol. 2007 Aug; 73 (16): 5261 - 7.

4. Ventura M., Canchaya C., Sinderen D., Fitzgerald G.F., Zink R. Bifidobacterium lactis DSM 10140: Identification of the atp (atpBEFHAGDC) Operon and Analysis of Its Genetic Structure, Characteristics, and Phylogeny.//Appl Environ Microbiol. 2004 May, p. 3110 - 3121.

5. Regnault B., Grimont F., Grimont H.F.D. Universal ribotyping method using a chemically labeled oligonucleotide probe mi[ture.//Res. Microbiol. 1997.

6. Higuchi R., Dollinger G., Walsh P.S., Griffith R. Simultaneous amplification and detection of specific DNA sequences.//Biotechnology. 1993. V. 10. P 413 - 417.

7. Sambrook J., Fritsch E.E., Maniatis T. Molekular Cloning: A Laboratory Manual.//Cold Sprind Harbor Laboratory Press, 1989.

8. Sanger F., Nicklen S., Coulson A.R. DNA sequencing chainterminating inhibitors.//Biotechnology. 1992. V. 24. P. 104 - 108.

П. 6.1.1.

1. Субботина M. E. Разработка методики генотипирования бифидобактерий на основе двухлокусного секвенирования с целью видовой идентификации штаммов. Дисс. канд. наук, М. - 2009.

2. Амерханова А.М. Научно-производственная разработка новых препаратов-синбиотиков и клинико-лабораторная оценка их эффективности. Дисс. доктора наук, М. - 2009.

3. Назырова Н.Р., Тимербаева Р.X., Туйгунов М.М. Антибиотико-резистентность штаммов, входящих в состав препаратов-пробиотиков.

4. I. Klare, C. Konstabel, G. Werner, G. Huys, V. Vankerckhoven, G. Kahlmeter, B. Hildebrandt, S. Muller-Bertling, W. Witte and H. Goossens. Antimicrobial susceptibilities of Lactobacillus, Pediococcus and Lactococcus human isolates and cultures intended for probiotic or nutritional use. J. of Antimicrobial Chemotherapy Advance Access published March 16, 2007.

П. 6.1.2. - 6.1.3.

1. Маниатис T., Фрич Э., Сэмбрук Дж. Методы генетической инженерии. Молекулярное клонирование. М: Мир. 1984. 479 с.

2. Botina SG, Tsygankov IuD, Sukhodolets VV. Identification of industrial strains of lactic acid bacteria by methods of molecular genetic typing Genetika. 2006 Dec; 42 (12): 1621 - 35.

3. Moon GS, Wegmann U, Gunning AP, Gasson MJ, Narbad A. solation and Characterization of a Theta-Type Cryptic Plasmid from Bifidobacterium longum FI10564. J Microbiol Biotechnol. 2009 Apr; 19 (4): 403 - 8.

4. Van Hal SJ, Wiklendt A, Espedido B, Ginn A, Iredell JR. Immediate appearance of plasmid-mediated multiple antibiotic resistance upon antibiotic selection: an argument for systematic resistance epidemiology. J Clin Microbiol. 2009 May 6. [Epub ahead of print].

5. Feld L, Bielak E, Hammer K, Wilcks A. Characterization of a small erythromycin resistance plasmid pLFE1 from the food-isolate Lactobacillus plantarum M345. Plasmid. 2009 May; 61 (3): 159 - 70.

6. Вестник РАМН т. 16 № 7 стр. 25 - 31 Белобородова Н. В., Осипов Г.А. Гомеостаз малых молекул микробного происхождения и его роль во взаимоотношениях микроорганизмов с хозяином. 1999 г.

7. Вестник РАМН № 2 стр. 141 - 145 Ксоян Ж.А., Белобородова Н.В., Осипов Г.А. Спектр и уровень содержания низкомолекулярных соединений микробного происхождения при периодической болезни. 2002 г.

8. Р 4.1.1672-03 «Руководство по методам контроля качества и безопасности биологически активных добавок к пище», Минздрав России, Москва 2004.

9. Pascual L.M., Daniele М.В., Ruiz F., Giordano W. et al. Lactobacillus rhamnosus L60, a potential probiotic isolated from the human vagina. J. Gen. Appl. Micribiol., 54, 141 - 148 (2008).

П. 6.1.6.

1. Патент РФ 2250465 от 20.04.2005 Коробейникова Э.Н. и др. «Количественное определения содержания белка и муцина (гликопротеинов) в слюне». Патентообладатель ГОУ ВПО «Тверская государственная медицинская академия Министерства здравоохранения и социального развития Российской Федерации» (ГОУ ВПО Тверская ГМА Минздрава России) (RU).

П. 6.1.7.

1. Блинкова Л.П. Битехнологические условия синтеза бактериоцинов/Блинкова Л.П., Машенцева Н.Г., Хорольский В.В., Горобец О.Б., Дорофеева Е. С.//Журн. микробиол. - 2006. - № 2, - С. 83 - 89.

2. Бондаренко В.М. Дисбиозы и препараты с пробиотической функцией/Бондаренко В. М., Воробьёв А.А.//Журн. микробиол. - 2004. - № 1. - С. 84 - 92.

3. Бондаренко В.М., Чупринина Р.П., Аладышева Ж.И. и др. Пробиотики и механизмы их лечебного действия//Эксперим. клин, гастроэнтерол. - 2004. - № 3. - С. 83 - 87.

4. Глушанова Н.А. Биосовместимость пробиотических и резидентных лактобацилл. ГИУВ, Новокузнецк. Россия/Глушакова Н.А., Блинов А.И.//Гастроэнтерол. - С. - Петербург. - 2005. - № 1 - 22 с.

5. Никитин В.М. Справочник методов биохимической экспресс-индикации микробов/Никитин В.М.//Кишинев, 1986. - 294 с.

6. Постникова Е.А. Поиск перспективных штаммов бифидобактерий и лактобацилл для разработки новых биопрепаратов/Постникова Е.А., Ефимов Б.А., Володин Н.Н., Кафарская Л.И.//Журн. микробиол. - 2004. - № 2. - С. 64 - 69.

7. Хмель И.А. Микроцины - пептидные антибиотики энтеробактерий: генетический контроль синтеза, структура, механизм действия/Хмель И.А.//Генетика. - 1999. - № 35 (1). - С. 5 - 16.

8. Altermann Е. Complete genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus/Altermann E., Russell W.M., Azcarate-Peril M.A. et al.//NCFM. Proc. Natl. Acad. Sci. USA. - 2005. - № 102 (11). - P. 3906 - 12.

9. Atrih A. Detection and characterization of a bacteriocin produced by Lactobacillus plantarum C19/Atrih A., Reknif N., Milliere J.B. et al.//Can. J. Microbiol. - 1993. - № 39. - P. 1173 - 1179.

10. Jamuna M. Isolation and characterization Lactobacilli from some traditional fermented foods and evaluation of the bacteriocins/Jamuna M., Jeevaratnam K.//J. Gen. Microbiol. - 2004. - № 50 (2). - P. 79 - 90.

11. Leal-Sanchez M.V. Optimization of bacteriocin production by batch fermentation of Lactobacillus plantarum LPCO10/Leal-Sanchez M.V., Jimenez-Diaz R., Maldonado-Barragan A. et al.//Appl. Environ. Microbiol. - 2002. - № 68 (9). - P. 4465 - 4471.

12. Maldonado A. Induction of plantaricin production in Lactobacillus plantarum NC8 after coculture with specific gram-positive bacteria is mediated by an autoinduction mechanism/Maldonado A., Jimenez-Diaz R., Ruiz-Barba J.L.//J. Bacteriol. - 2004. - № 186 (5). - P. 1556 - 1564.

П. 6.1.8.

1. Mercenier A., Foligne B., Dennin V., Goudercourt D., Pot B., Roshat F. Selection of candidate probiotic strains protecting against murine acute colitis.

П. 6.3.1.

1. Блинкова Л.П. Битехнологические условия синтеза бактериоцинов/Блинкова Л.П., Машенцева Н.Г., Хорольский В.В., Горобец О.Б., Дорофеева Е.С.//Журн. микробиол. - 2006. - № 2, - С. 83 - 89.

2. Бондаренко В.М. Дисбиозы и препараты с пробиотической функцией/Бондаренко В.М., Воробьёв А.А.//Журн. микробиол. - 2004. - № 1. - С. 84 - 92.

3. Бондаренко В.М., Чупринина Р.П., Аладышева Ж.И. и др. Пробиотики и механизмы их лечебного действия//Эксперим. клин, гастроэнтерол. - 2004. - № 3. - С. 83 - 87.

4. Глушанова Н.А. Биосовместимость пробиотических и резидентных лактобацилл. ГИУВ, Новокузнецк. Россия/Глушакова Н.А., Блинов А.И.//Гастроэнтерол. - С.-Петербург. - 2005. - № 1 - 22 с.

5. Никитин В. М. Справочник методов биохимической экспресс-индикации микробов/Никитин В. М.//Кишинев, 1986. - 294 с.

6. Постникова Е.А. Поиск перспективных штаммов бифидобактерий и лактобацилл для разработки новых биопрепаратов/Постникова Е.А., Ефимов Б.А., Володин Н.Н., Кафарская Л.И.//Журн. микробиол. - 2004. - № 2. - С. 64 - 69.

7. Хмель И.А. Микроцины - пептидные антибиотики энтеробактерий: генетический контроль синтеза, структура, механизм действия/Хмель И.А//Генетика, - 1999. - № 35 (1). - С. 5 - 16.

8. Altermann Е. Complete genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus/Altermann E., Russell W.M., Azcarate-Peril M.A. et al.//NCFM. Proc. Natl. Acad. Sci. USA. - 2005. - № 102 (11). - P. 3906 - 12.

9. Atrih A. Detection and characterization of a bacteriocin produced by Lactobacillus plantarum C19/Atrih A., Reknif N., Milliere J.B. et al.//Can. J. Microbiol. - 1993, - № 39. - P. 1173 - 1179.

10. Jamuna M. Isolation and characterization Lactobacilli from some traditional fermented foods and evaluation of the bacteriocins/Jamuna M., Jeevaratnam K.//J. Gen. Microbiol. - 2004. - № 50 (2). - P. 79 - 90.

11. Leal-Sanchez M.V. Optimization of bacteriocin production by batch fermentation of Lactobacillus plantarum LPCO10/Leal-Sanchez M.V., Jimenez-Diaz R., Maldonado-Barragan A. et al.//Appl. Environ. Microbiol. - 2002. - № 68 (9). - P. 4465 - 4471.

12. Maldonado A. Induction of plantaricin production in Lactobacillus plantarum NC8 after coculture with specific gram-positive bacteria is mediated by an autoinduction mechanism/Maldonado A., Jimenez-Diaz R., Ruiz-Barba J.L.//J. Bacteriol. - 2004. - № 186 (5). - P. 1556 - 1564.

П. 6.4.1.5.

1. МУК 4.1/4.2.588-96 «Методы контроля медицинских иммунобиологических препаратов», 1996.

2. МУ 3.3.2.684-98 «Сертификация медицинских биологических препаратов», 1998.

3. Осипова И.Г. Экспериментально-клиническое изучение споровых пробиотиков/Дис. док. биол. наук, Москва, 2007 г.

4. Rifai, N., et al., Lipids Lipoproteins, and Apolipoproteins. Teitz Fundamentals of Clinical Chemistry, 5th Ed., Burtis, C.A and Ashwood, E.R. (W.B. Saunders eds. Philadelphia USA), (2001), 463.

П. 7

1. Dubois, M. Colorimetric method for determination of sugars and related substances/M. Dubois//Anal. Chem. - 28. - 1956. - P. 350 - 356.

Приложение 1

Микробиологический и молекулярно-генетический
паспорт штамма микроорганизма

Номер __________________________

Дата депонирования ______________

1. Полное наименование организации-депозитора.

2. Юридический и фактический (для переписки) адреса и телефон, адрес электронной почты с указанием фамилии, имени и отчества контактного лица.

3. Авторский коллектив (фамилии, и. о. всех авторов штамма).

4. Причина депонирования:

- для целей патентной процедуры;

- хранение;

- гарантийное хранение.

(нужное подчеркнуть).

5. Родовое и видовое название культуры.

6. Номер или наименование штамма.

7. Родословная штамма, номер в другой коллекции (если он существует).

8. Источник выделения штамма.

9. Где и когда (наименование организации и ее адрес) идентифицирована культура (данные, на основании которых было сделано заключение о родовой/видовой принадлежности культуры должны прилагаться к паспорту).

10. Род, вид, подвид (вариант), штамм.

11. Индикация в коллекции: порядковый номер, шифр, номер контейнера.

12. Количество единиц хранения.

13. Журнальная запись о дате пересева культуры, серии, дате.

14. Характерные признаки:

- морфология клеток;

- реакция по Граму;

- спорообразование.

15. Среды для культивирования:

- бульонные;

- полужидкие;

- плотные.

16. Условия и время инкубации.

17. Биохимическая активность (с указанием метода и тест-системы, с помощью которой она определялась).

18. Антагонистическая активность (с указанием метода определения и тест-культур).

19. Устойчивость к антибиотикам.

20. Содержание ГЦ.

21. Генотипирование (с указанием нуклеотидной последовательности фрагментов минимально двух локусов генома штамма и метода определения).

22. Способ длительного сохранения.

23. Условия хранения.

24. Гарантированное время хранения.

25. Среды контроля.

26. Среды накопления.

27. Характерный рост на селективных средах и средах накопления.

28. Состав защитной среды для обеспечения длительной консервации при сублимационном высушивании.

29. Назначение штамма.

Приложение 2

Пограничные значения чувствительности к антимикробным
веществам лактобактерий в микрометоде серийных разведений
[по I. Klare et al., 2007]

Антимикробный препарат

Вид штамма

Диапазон минимальной ингибирующей концентрации (МИК), мг/л

МИК50, мг/л

МИК90, мг/л

Величины пограничных значений, мг/л

1

2

3

4

5

6

Пенициллин

Pc. acidilactici

0,125 - 1

0,25

0,5

1

Pc. pentosaceus

0,25 - 0,5

0,5

0,5

1

L. rhamnosus

0,125 - 2

0,25

1

2

L. paracasei

0,063 - 1

0,25

0,5

1

L. plantarum

0,5 - 2

1

2

2

L. fermentum

0,063 - 0,5

0,25

0,25

0,5

L. gasseri

≤ 0,032 - 0,063

≤ 0,032

0,063

0,125

L. acidophilus

≤ 0,032 - 0,125

0,125

0,125

0,25

L. crispatus

≤ 0,032 - 0,25

0,125

0,25

0,25

L. johnsonii

0,063 - 0,125

0,125

0,125

0,25

L. delbrueckii

≤ 0,032 - 0,125

≤ 0,032

0,063

0,125

L. reuteri

0,063 - 16

0,5

4

IE

Ампициллин

Pc. acidilactici

1 - 2

1

2

4

Pc. pentosaceus

1 - 2

2

2

4

L. rhamnosus

0,25 - 4

1

2

4

L. paracasei

0,125 - 2

0,5

1

2

L. plantarum

0,125 - 2

0,25

1

2

L. fermentum

0,063 - 0,25

0,125

0,25

0,5

L. gasseri

0,063 - 0,25

0,125

0,25

0,5

L. acidophilus

0,125 - 0,5

0,25

0,5

0,5

L. crispatus

0,125 - 1

0,5

1

1

L. johnsonii

0,125 - 0,5

0,5

0,5

1

L. delbrueckii

≤ 0,032 - 0,5

0,063

0,25

0,5

L. reuteri

0,125 - 4

0,5

4

2

Ампициллин/сульбактам

Pc. acidilactici

1 - 2

1

2

4

Pc. pentosaceus

1 - 2

2

2

4

L. rhamnosus

0,25 - 4

1

1

4

L. paracasei

0,125 - 2

0,5

1

2

L. plantarum

0,125 - 1

0,25

0,5

2

L. fermentum

0,063 - 0,25

0,125

0,25

0,5

L. gasseri

≤ 0,032 - 0,25

0,125

0,25

0,5

L. acidophilus

0,125 - 0,5

0,25

0,5

0,5

L. crispatus

0,063 - 1

0,5

0,5

1

L. johnsonii

0,063 - 0,5

0,25

0,5

1

L. delbrueckii

≤ 0,032 - 0,25

0,063

0,125

0,5

L. reuteri

0,125 - 2

0,5

2

2

Гентамицин

Pc. acidilactici

2 - 8

4

4

8

Pc. pentosaceus

2 - 4

2

2

4

L. rhamnosus

≤ 1 - 8

1

2

8

L. paracasei

≤ 1 - 8

2

4

8

L. plantarum

≤ 1 - 8

1

2

8

L. fermentum

≤ 1 - 2

1

1

IE

L. gasseri

≤ 1 - 4

1

2

4

L. acidophilus

≤ 1 - 2

1

2

4

L. crispatus

≤ 1 - 4

2

4

4

L. johnsonii

≤ 1 - 8

4

4

8

L. delbrueckii

≤ 1 - 4

1

2

4

L. reuteri

≤ 1

1

1

IE

Стрептомицин

Pc. acidilactici

16 - 128

64

128

128

Pc. pentosaceus

32 - 128

32

64

128

L. rhamnosus

≤ 2 - > 4096

4

16

32

L. paracasei

≤ 2 - > 4096

16

32

64

L. plantarum

4 - 128

16

32

64

L. fermentum

4 - 64

8

16

64

L. gasseri

≤ 2 - 8

2

4

8

L. acidophilus

≤ 2 - 8

2

4

8

L. crispatus

≤ 2 - 32

4

16

16

L. johnsonii

≤ 2 - 16

4

8

16

L. delbrueckii

≤ 2 - 16

4

8

16

L. reuteri

≤ 2 - 16

4

8

16

Ванкомицин

Pc. acidilactici

> 256

> 256

> 256

IE

Pc. pentosaceus

> 256

> 256

> 256

IE

L. rhamnosus

≥ 256

> 256

> 256

IE

L. paracasei

≥ 256

> 256

> 256

IE

L. plantarum

≥ 256

> 256

> 256

IE

L. fermentum

32 - > 256

256

> 256

IE

L. gasseri

0,25 - 1

0,5

1

1

L. acidophilus

0,25 - 0,5

0,5

0,5

1

L. crispatus

0,25 - 0,5

0,5

0,5

1

L. johnsonii

0,25 - 1

0,5

1

1

L. delbrueckii

0,25 - 0,5

0,25

0,5

1

L. reuteri

128 - 256

256

256

IE

Тейкопланин

Pc. acidilactici

64 - > 256

> 256

> 256

IE

Pc. pentosaceus

> 256

> 256

> 256

IE

L. rhamnosus

64 - > 256

> 256

> 256

IE

L. paracasei

64 - > 256

256

> 256

IE

L. plantarum

32 - > 256

256

> 256

IE

L. fermentum

2 - > 256

128

> 256

IE

L. gasseri

≤ 0,125 - 0,25

≤ 0,125

≤ 0,125

IE

L. acidophilus

≤ 0,125

≤ 0,125

≤ 0,125

IE

L. crispatus

≤ 0,125 - 0,25

≤ 0,125

≤ 0,125

IE

L. johnsonii

≤ 0,125 - 0,25

≤ 0,125

≤ 0,125

IE

L. delbrueckii

≤ 0,125 - 0,25

≤ 0,125

≤ 0,125

IE

L. reuteri

64 - 256

128

256

IE

Хинопрестин/дальфопристин

Pc. acidilactici

0,063 - 1

0,5

1

2

Pc. pentosaceus

0,5 - 2

1

2

2

L. rhamnosus

≤ 0,032 - 1

0,25

0,5

1

L. paracasei

≤ 0,032 - 1

0,25

0,25

1

L. plantarum

0,063 - 1

0,25

1

1

L. fermentum

0,063 - 0,125

0,125

0,125

0,25

L. gasseri

≤ 0,032 - 0,25

0,125

0,125

0,25

L. acidophilus

≤ 0,032 - 0,5

0,125

0,25

0,5

L. crispatus

≤ 0,032 - 0,25

0,063

0,25

0,25

L. johnsonii

0,063 - 0,25

0,125

0,25

0,5

L. delbrueckii

≤ 0,032 - 0,25

0,063

0,063

0,25

L. reuteri

≤ 0,032 - 0,125

0,125

0,125

0,25

Эритромицин

Pc. acidilactici

0,063 - 0,25

0,063

0,5

0,25

Pc. pentosaceus

0,032 - 0,25

0,063

0,125

0,25

L. rhamnosus

≤ 0,016 - > 32

0,032

0,063

0,25

L. paracasei

≤ 0,016 - 0,25

0,032

0,063

0,25

L. plantarum

≤ 0,016 - 0,5

0,125

0,25

0,5

L. fermentum

≤ 0,016 - 0,125

0,032

0,063

0,125

L. gasseri

≤ 0,016 - 0,032

≤ 0,016

0,032

0,063

L. acidophilus

≤ 0,016 - 0,063

0,032

0,063

0,063

L. crispatus

≤ 0,016 - > 32

0,032

> 32

0,063

L. johnsonii

≤ 0,016 - 0,063

≤ 0,016

0,032

0,063

L. delbrueckii

≤ 0,016 - 0,125

≤ 0,016

0,032

0,063

L. reuteri

0,032 - 0,25

0,032

0,125

0,25

Клиндамицин

Pc. acidilactici

≤ 0,032 - 0,5

≤ 0,032

0,063

IE

Pc. pentosaceus

≤ 0,032

≤ 0,032

≤ 0,032

IE

L. rhamnosus

≤ 0,032 - 8

0,063

0,125

0,5

L. paracasei

≤ 0,032 - 0,25

≤ 0,032

0,063

0,25

L. plantarum

≤ 0,032 - 1

0,125

0,5

0,5

L. fermentum

≤ 0,032 - 0,125

≤ 0,032

≤ 0,032

0,125

L. gasseri

≤ 0,032 - 2

0,5

2

IE

L. acidophilus

≤ 0,032 - 0,5

0,125

0,5

0,5

L. crispatus

≤ 0,032 - 32

0,063

> 32

0,25

L johnsonii

≤ 0,032 - 1

0,063

0,25

0,5

L. delbrueckii

≤ 0,032 - 0,063

≤ 0,032

≤ 0,032

IE

L. reuteri

≤ 0,032 - 0,063

≤ 0,032

≤ 0,032

IE

Окситетрациклин

Pc. acidilactici

4 - 16

8

16

32

Pc. pentosaceus

8 - 16

16

16

32

L. rhamnosus

0,125 - 16

0,5

0,5

1

L. paracasei

0,25 - 16

0,5

1

2

L. plantarum

4 - > 128

8

16

32

L. fermentum

0,5 - 4

2

4

8

L. gasseri

0,125 - 4

1

2

4

L. acidophilus

0,25 - 2

0,5

1

2

L. crispatus

0,25 - 64

1

64

2

L. johnsonii

0,5 - 16

0,5

16

2

L. delbrueckii

≤ 0,063 - 2

0,5

2

2

L. reuteri

2 - > 128

4

> 128

8

Хлорамфеникол

Pc. acidilactici

2 - 4

2

4

8

Pc. pentosaceus

1 - 1

2

4

4

L. rhamnosus

0,5 - 8

2

4

8

L. paracasei

1 - 8

2

4

8

L. plantarum

2 - 8

4

4

8

L. fermentum

2 - 4

2

4

8

L. gasseri

0,5 - 4

2

2

4

L. acidophilus

0,5 - 4

2

4

8

L. crispatus

1 - 4

1

4

4

L. johnsonii

1 - 4

2

4

4

L. delbrueckii

1 - 4

2

2

4

L. reuteri

1 - 4

2

4

4

Фусидовая кислота

Pc. acidilactici

0,5 - 16

4

4

8

Pc. pentosaceus

2 - 4

2

4

8

L. rhamnosus

2 - > 128

128

> 128

IE

L. paracasei

16 - > 128

64

128

256

L. plantarum

2 - 32

16

16

32

L. fermentum

0,25 - 1

0,5

1

1

L. gasseri

8 - > 128

64

128

256

L. acidophilus

32 - > 128

64

128

256

L. crispatus

4 - 128

32

64

128

L. johnsonii

16 - 128

64

128

128

L. delbrueckii

32 - 128

64

128

128

L. reuteri

0,125 - 2

0,5

2

2

Линезолид

Pc. acidilactici

0,5 - 2

1

2

4

Pc. pentosaceus

0,5 - 2

1

1

2

L. rhamnosus

0,125 - 2

1

1

2

L. paracasei

0,25 - 2

1

1

4

L. plantarum

1 - 2

1

2

4

L. fermentum

0,5 - 2

1

1

2

L. gasseri

0,5 - 2

1

2

2

L. acidophilus

0,5 - 4

1

4

4

L. crispatus

0,5 - 2

1

2

2

L. johnsonii

0,5 - 2

1

2

2

L. delbrueckii

0,5 - 1

0,5

1

1

L. reuteri

0,5 - 2

1

2

2

Триметоприм

Pc. acidilactici

8 - > 512

32

128

IE

Pc. pentosaceus

8 - 128

16

32

IE

L. rhamnosus

1 - > 512

32

64

IE

L. paracasei

≤ 0,25 - > 512

2

16

IE

L. plantarum

≤ 0,25 - > 512

2

32

IE

L. fermentum

≤ 0,25 - 256

4

64

IE

L. gasseri

≤ 0,25 - > 512

8

> 512

IE

L. acidophilus

0,5 - > 512

4

512

IE

L. crispatus

≤ 0,25 - > 512

8

256

IE

L. johnsonii

≤ 0,25 - > 512

256

> 512

IE

L. delbrueckii

128 - > 512

> 512

> 512

IE

L. reuteri

16 - > 512

64

> 512

IE

Триметоприм/сульфометоксазол

Pc. acidilactici

64 - 512

256

512

IE

Pc. pentosaceus

128 - 512

256

256

IE

L. rhamnosus

16 - > 512

256

512

IE

L. paracasei

0,5 - > 512

16

128

IE

L. plantarum

0,5 - > 512

4

256

IE

L. fermentum

2 - 512

16

128

IE

L. gasseri

0,5 - > 512

128

> 512

IE

L. acidophilus

4 - > 512

64

512

IE

L. crispatus

≤ 0,25 - > 512

128

> 512

IE

L. johnsonii

1 - > 512

512

> 512

IE

L. delbrueckii

256 - > 512

512

> 512

IE

L. reuteri

32 - > 512

256

> 512

IE

Сокращения

ЖКТ - желудочно-кишечный тракт

ДНК - дезоксирибонуклеиновая кислота

570
Мне нравится
Комментировать Добавить в закладки

Комментарии могут оставлять только зарегистрированные пользователи.

Пожалуйста зарегистрируйтесь или авторизуйтесь на сайте.